RegulonDB RegulonDB 10.9: Operon Form
   

envY-ompT operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: envY-ompT
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: ompT
Gene(s): ompT   Genome Browser M3D Gene expression COLOMBOS
Note(s): A potential RNA G-quadruplex structure, formed by guanine-rich sequences located in the coding sequence region of the gene, was identified for ompT . This structure could regulate the expression of the gene, as observed for hemL gene expression 31964733.
Promoter
Name: ompTp
+1: 585665
Distance from start of the gene: 32
Sequence: atataaacagtggagcaatatgtaattgactcattaagttagatataaaaaatacatattCaatcattaaaacgattgaat
Evidence: [RS-EPT-CBR]
[TIM]
Reference(s): [1] Eguchi Y., et al., 2004
[2] Salgado H, et al., 2012
TF binding sites (TFBSs)
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal PhoP-Phosphorylated activator ompTp 585706 585722 -49.0 taaacaaaatATAAACAGTGGAGCAATAtgtaattgac nd [APIORCISFBSCS], [GEA] [4]
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA OmrB ompT repressor 585614 585645 CCCAGAAGUUUCGCCCGCAUAAAAGUUCUCCA MRNA-DEGRADATION [SM] [3]
small regulatory RNA OmrA ompT repressor 585614 585645 CCCAGAAGUUUCGCCCGCAUAAAAGUUCUCCA MRNA-DEGRADATION [SM] [3]


Transcription unit       




Reference(s)    

 [1] Eguchi Y., Okada T., Minagawa S., Oshima T., Mori H., Yamamoto K., Ishihama A., Utsumi R., 2004, Signal transduction cascade between EvgA/EvgS and PhoP/PhoQ two-component systems of Escherichia coli., J Bacteriol 186(10):3006-14

 [2] Salgado H, Peralta-Gil M, Gama-Castro S, Santos-Zavaleta A, Muñiz-Rascado L, García-Sotelo JS, Weiss V, Solano-Lira H, Martínez-Flores I, Medina-Rivera A, Salgado-Osorio G, Alquicira-Hernández S, Alquicira-Hernández K, López-Fuentes A, Porrón-Sotelo L, Huerta AM, Bonavides-Martínez C, Balderas-Martínez YI, Pannier L, Olvera M, Labastida A, Jiménez-Jacinto V, Vega-Alvarado L, Del Moral-Chávez V, Hernández-Alvarez A, Morett E, Collado-Vides J., 2012, RegulonDB v8.0: omics data sets, evolutionary conservation, regulatory phrases, cross-validated gold standards and more., Nucleic Acids Res.

 [3] Guillier M., Gottesman S., 2008, The 5' end of two redundant sRNAs is involved in the regulation of multiple targets, including their own regulator., Nucleic Acids Res 36(21):6781-94

 [4] Zwir I., Shin D., Kato A., Nishino K., Latifi T., Solomon F., Hare JM., Huang H., Groisman EA., 2005, Dissecting the PhoP regulatory network of Escherichia coli and Salmonella enterica., Proc Natl Acad Sci U S A 102(8):2862-7

 [5] Blattner FR., Plunkett G., Bloch CA., Perna NT., Burland V., Riley M., Collado-Vides J., Glasner JD., Rode CK., Mayhew GF., Gregor J., Davis NW., Kirkpatrick HA., Goeden MA., Rose DJ., Mau B., Shao Y., 1997, The complete genome sequence of Escherichia coli K-12., Science 277(5331):1453-74

 [6] Lundrigan MD., Earhart CF., 1984, Gene envY of Escherichia coli K-12 affects thermoregulation of major porin expression., J Bacteriol 157(1):262-8


RegulonDB