![]() ![]() ![]() ![]() |
Name: | cirA | ||||||||||
Synonym(s): | OP00019, cir | ||||||||||
Gene(s): | cirA Genome Browser M3D Gene expression COLOMBOS | ||||||||||
Evidence: | [EXP-IDA-BOUNDARIES-DEFINED] Boundaries of transcription experimentally identified [EXP-IMP-POLAR-MUTATION] Polar mutation |
||||||||||
Reference(s): | [1] Griggs DW., et al., 1987 | ||||||||||
Promoter | |||||||||||
Name: | cirAp1 | ||||||||||
+1: | 2246929 | ||||||||||
Sigma Factor: | Sigma70 Sigmulon | ||||||||||
Distance from start of the gene: | 160 | ||||||||||
Sequence: |
ggatataaaatttaacatttggattgataattgttatcgtttgcattatcgttacgccgcAatcaaaaaaggctgacaaat -35 -10 +1 |
||||||||||
Evidence: |
[COMP-AINF] [COMP-HINF] [COMP-HINF-POSITIONAL-IDENTIFICATION] [EXP-IDA-TRANSCRIPTION-INIT-MAPPING] |
||||||||||
Reference(s): |
[1] Griggs DW., et al., 1987 [2] Huerta AM., et al., 2003 |
Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence | Confidence level (C: Confirmed, S: Strong, W: Weak) | Reference(s) | |||
---|---|---|---|---|---|---|---|---|---|---|---|
LeftPos | RightPos | Central Rel-Pos | Sequence | ||||||||
remote | CRP-cyclic-AMP | activator | cirAp1 | 2246801 | 2246823 | 118.5 | ggacgtgaagAAGATGTGAGCGATAACCCATTTtattttcgta | nd | [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS] | W | [8] |
Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence | Confidence level (C: Confirmed, S: Strong, W: Weak) | Reference(s) | |||
---|---|---|---|---|---|---|---|---|---|---|---|
LeftPos | RightPos | Central Rel-Pos | Sequence | ||||||||
proximal | Fur-Fe2+ | repressor | cirAp1 | 2246937 | 2246955 | -17.0 | tgataattgtTATCGTTTGCATTATCGTTacgccgcaat | nd | [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS] | W | [6], [7] |
proximal | Fur-Fe2+ | repressor | cirAp1 | 2246943 | 2246961 | -23.0 | ttggattgatAATTGTTATCGTTTGCATTatcgttacgc | nd | [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-CELLULAR-EXTRACTS] | nd | [4] |
proximal | Fur-Fe2+ | repressor | cirAp1 | 2246949 | 2246967 | -29.0 | taacatttggATTGATAATTGTTATCGTTtgcattatcg | nd | [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] | W | [4], [5], [6], [7] |
proximal | Fur-Fe2+ | repressor | cirAp1 | 2246955 | 2246973 | -35.0 | aaaatttaacATTTGGATTGATAATTGTTatcgtttgca | nd | [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] | W | [4], [5], [6], [7] |
sRNA | TU Regulated | Function | Binding Sites | Regulatory Mechanism | Evidence (Confirmed, Strong, Weak) | Reference(s) | ||
---|---|---|---|---|---|---|---|---|
PosLeft | PosRight | Target sequence (mRNA) | ||||||
small regulatory RNA OmrA | cirA | repressor | 2246779 | 2246804 | CCAUGAGGUAACUACGAAAAUAAAAU | MRNA-DEGRADATION | [EXP-IMP-SITE-MUTATION] | [3] |
small regulatory RNA OmrB | cirA | repressor | 2246779 | 2246804 | CCAUGAGGUAACUACGAAAAUAAAAU | MRNA-DEGRADATION | [EXP-IMP-SITE-MUTATION] | [3] |
Name: | cirA | ||||||||||
Synonym(s): | OP00019 | ||||||||||
Gene(s): | cirA Genome Browser M3D Gene expression COLOMBOS | ||||||||||
Evidence: | [EXP-IDA-BOUNDARIES-DEFINED] Boundaries of transcription experimentally identified [EXP-IMP-POLAR-MUTATION] Polar mutation |
||||||||||
Reference(s): | [1] Griggs DW., et al., 1987 | ||||||||||
Promoter | |||||||||||
Name: | cirAp2 | ||||||||||
+1: | 2246942 | ||||||||||
Sigma Factor: | Sigma70 Sigmulon | ||||||||||
Distance from start of the gene: | 173 | ||||||||||
Sequence: |
tgacaaatcatgcggatataaaatttaacatttggattgataattgttatcgtttgcattAtcgttacgccgcaatcaaaa -35 -10 +1 |
||||||||||
Evidence: |
[COMP-AINF] [COMP-HINF] [EXP-IDA-TRANSCRIPTION-INIT-MAPPING] |
||||||||||
Reference(s): |
[1] Griggs DW., et al., 1987 [2] Huerta AM., et al., 2003 |
Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence | Confidence level (C: Confirmed, S: Strong, W: Weak) | Reference(s) | |||
---|---|---|---|---|---|---|---|---|---|---|---|
LeftPos | RightPos | Central Rel-Pos | Sequence | ||||||||
remote | CRP-cyclic-AMP | activator | cirAp2 | 2246801 | 2246823 | 131.5 | ggacgtgaagAAGATGTGAGCGATAACCCATTTtattttcgta | nd | [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS] | W | [8] |
Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence | Confidence level (C: Confirmed, S: Strong, W: Weak) | Reference(s) | |||
---|---|---|---|---|---|---|---|---|---|---|---|
LeftPos | RightPos | Central Rel-Pos | Sequence | ||||||||
proximal | Fur-Fe2+ | repressor | cirAp2 | 2246937 | 2246955 | -4.0 | tgataattgtTATCGTTTGCATTATCGTTacgccgcaat | nd | [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS] | W | [6], [7] |
proximal | Fur-Fe2+ | repressor | cirAp2 | 2246949 | 2246967 | -16.0 | taacatttggATTGATAATTGTTATCGTTtgcattatcg | nd | [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] | W | [5], [6], [7] |
proximal | Fur-Fe2+ | repressor | cirAp2 | 2246955 | 2246973 | -22.0 | aaaatttaacATTTGGATTGATAATTGTTatcgtttgca | nd | [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] | W | [5], [6], [7] |
sRNA | TU Regulated | Function | Binding Sites | Regulatory Mechanism | Evidence (Confirmed, Strong, Weak) | Reference(s) | ||
---|---|---|---|---|---|---|---|---|
PosLeft | PosRight | Target sequence (mRNA) | ||||||
small regulatory RNA OmrB | cirA | repressor | 2246779 | 2246804 | CCAUGAGGUAACUACGAAAAUAAAAU | MRNA-DEGRADATION | [EXP-IMP-SITE-MUTATION] | [3] |
small regulatory RNA OmrA | cirA | repressor | 2246779 | 2246804 | CCAUGAGGUAACUACGAAAAUAAAAU | MRNA-DEGRADATION | [EXP-IMP-SITE-MUTATION] | [3] |
Reference(s) |
![]() |
---|---|