![]() ![]() ![]() ![]() |
Name: | cirA | |||||||||
Synonym(s): | OP00019, cir | |||||||||
Gene(s): | cirA Genome Browser M3D Gene expression COLOMBOS | |||||||||
Evidence: | [BTEI] Boundaries of transcription experimentally identified [PM] Polar mutation |
|||||||||
Reference(s): | [1] Griggs DW., et al., 1987 | |||||||||
Promoter | ||||||||||
Name: | cirAp1 | |||||||||
+1: | 2246929 | |||||||||
Sigma Factor: | Sigma70 Sigmulon | |||||||||
Distance from start of the gene: | 160 | |||||||||
Sequence: |
ggatataaaatttaacatttggattgataattgttatcgtttgcattatcgttacgccgcAatcaaaaaaggctgacaaat -35 -10 +1 |
|||||||||
Evidence: |
[HIPP] [ICWHO] [IHBCE] [TIM] |
|||||||||
Reference(s): |
[1] Griggs DW., et al., 1987 [2] Huerta AM., et al., 2003 |
Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence (Confirmed, Strong, Weak) | Reference(s) | |||
---|---|---|---|---|---|---|---|---|---|---|
LeftPos | RightPos | Central Rel-Pos | Sequence | |||||||
remote | CRP-cyclic-AMP | activator | cirAp1 | 2246801 | 2246823 | 118.5 | ggacgtgaagAAGATGTGAGCGATAACCCATTTtattttcgta | nd | [GEA], [APIORCISFBSCS] | [8] |
Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence (Confirmed, Strong, Weak) | Reference(s) | |||
---|---|---|---|---|---|---|---|---|---|---|
LeftPos | RightPos | Central Rel-Pos | Sequence | |||||||
proximal | Fur-Fe2+ | repressor | cirAp1 | 2246937 | 2246955 | -17.0 | tgataattgtTATCGTTTGCATTATCGTTacgccgcaat | nd | [GEA], [AIBSCS] | [6], [7] |
proximal | Fur-Fe2+ | repressor | cirAp1 | 2246943 | 2246961 | -23.0 | ttggattgatAATTGTTATCGTTTGCATTatcgttacgc | nd | [APIORCISFBSCS], [BCE] | [4] |
proximal | Fur-Fe2+ | repressor | cirAp1 | 2246949 | 2246967 | -29.0 | taacatttggATTGATAATTGTTATCGTTtgcattatcg | nd | [GEA], [APIORCISFBSCS], [BPP] | [4], [5], [6], [7] |
proximal | Fur-Fe2+ | repressor | cirAp1 | 2246955 | 2246973 | -35.0 | aaaatttaacATTTGGATTGATAATTGTTatcgtttgca | nd | [GEA], [APIORCISFBSCS], [BPP] | [4], [5], [6], [7] |
sRNA | TU Regulated | Function | Binding Sites | Regulatory Mechanism | Evidence (Confirmed, Strong, Weak) | Reference(s) | ||
---|---|---|---|---|---|---|---|---|
PosLeft | PosRight | Target sequence (mRNA) | ||||||
small regulatory RNA OmrA | cirA | repressor | 2246779 | 2246804 | CCAUGAGGUAACUACGAAAAUAAAAU | MRNA-DEGRADATION | [SM] | [3] |
small regulatory RNA OmrB | cirA | repressor | 2246779 | 2246804 | CCAUGAGGUAACUACGAAAAUAAAAU | MRNA-DEGRADATION | [SM] | [3] |
Name: | cirA | |||||||||
Synonym(s): | OP00019 | |||||||||
Gene(s): | cirA Genome Browser M3D Gene expression COLOMBOS | |||||||||
Evidence: | [BTEI] Boundaries of transcription experimentally identified [PM] Polar mutation |
|||||||||
Reference(s): | [1] Griggs DW., et al., 1987 | |||||||||
Promoter | ||||||||||
Name: | cirAp2 | |||||||||
+1: | 2246942 | |||||||||
Sigma Factor: | Sigma70 Sigmulon | |||||||||
Distance from start of the gene: | 173 | |||||||||
Sequence: |
tgacaaatcatgcggatataaaatttaacatttggattgataattgttatcgtttgcattAtcgttacgccgcaatcaaaa -35 -10 +1 |
|||||||||
Evidence: |
[ICWHO] [IHBCE] [TIM] |
|||||||||
Reference(s): |
[1] Griggs DW., et al., 1987 [2] Huerta AM., et al., 2003 |
Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence (Confirmed, Strong, Weak) | Reference(s) | |||
---|---|---|---|---|---|---|---|---|---|---|
LeftPos | RightPos | Central Rel-Pos | Sequence | |||||||
remote | CRP-cyclic-AMP | activator | cirAp2 | 2246801 | 2246823 | 131.5 | ggacgtgaagAAGATGTGAGCGATAACCCATTTtattttcgta | nd | [GEA], [APIORCISFBSCS] | [8] |
Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence (Confirmed, Strong, Weak) | Reference(s) | |||
---|---|---|---|---|---|---|---|---|---|---|
LeftPos | RightPos | Central Rel-Pos | Sequence | |||||||
proximal | Fur-Fe2+ | repressor | cirAp2 | 2246937 | 2246955 | -4.0 | tgataattgtTATCGTTTGCATTATCGTTacgccgcaat | nd | [GEA], [AIBSCS] | [6], [7] |
proximal | Fur-Fe2+ | repressor | cirAp2 | 2246949 | 2246967 | -16.0 | taacatttggATTGATAATTGTTATCGTTtgcattatcg | nd | [GEA], [APIORCISFBSCS], [BPP] | [5], [6], [7] |
proximal | Fur-Fe2+ | repressor | cirAp2 | 2246955 | 2246973 | -22.0 | aaaatttaacATTTGGATTGATAATTGTTatcgtttgca | nd | [GEA], [APIORCISFBSCS], [BPP] | [5], [6], [7] |
sRNA | TU Regulated | Function | Binding Sites | Regulatory Mechanism | Evidence (Confirmed, Strong, Weak) | Reference(s) | ||
---|---|---|---|---|---|---|---|---|
PosLeft | PosRight | Target sequence (mRNA) | ||||||
small regulatory RNA OmrB | cirA | repressor | 2246779 | 2246804 | CCAUGAGGUAACUACGAAAAUAAAAU | MRNA-DEGRADATION | [SM] | [3] |
small regulatory RNA OmrA | cirA | repressor | 2246779 | 2246804 | CCAUGAGGUAACUACGAAAAUAAAAU | MRNA-DEGRADATION | [SM] | [3] |
Reference(s) |
![]() |
---|---|