RegulonDB RegulonDB 11.1: Operon Form
   

ompF operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: ompF
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: ompF
Synonym(s): OP00066
Gene(s): ompF   Genome Browser M3D Gene expression COLOMBOS
Note(s): It was proved in an experiment with increasing concentrations of the antibiotic tetracycline that the ompC gene is induced in low concentrations (1.5 and 4 mg/L), but not in high ones (10 mg/L) Viveiros M, Dupont M, Rodrigues L, Couto I, Davin-Regli A, Martins M, Pagès JM, Amaral L,2007 This result might be attributed to the constant increase during the experiment of micF gene expression, whose sRNA product negatively regulates the expression of the ompF gene Viveiros M, Dupont M, Rodrigues L, Couto I, Davin-Regli A, Martins M, Pagès JM, Amaral L,2007.
MarA and Rob independently regulate expression of the outer membrane porin F gene, ompF, in response to salicylate, activating micF gene expression in response to salicylate Chubiz LM, Rao CV,2011. In addition, MarA can also repress OmpF expression through a MicF-independent pathway Chubiz LM, Rao CV,2011. On the other hand, reduction in ompC expression in a tolC mutant was due primarily to Rob Chubiz LM, Rao CV,2011.
The expression of the gene ompF is increased under acidic growth conditions in either aerobiosis or microaerobiosis Marzan LW,2013 The increased expression under aerobiosis appears to be caused by the transcription factor PhoB Marzan LW,2013
Under NlpE outer membrane lipoprotein overexpression, the transcription of the ompF gene is decreased by CpxR Raivio TL,2013
A potential RNA G-quadruplex structure, formed by guanine-rich sequences located in the coding sequence region of the gene, was identified for ompF . This structure could regulate the expression of the gene, as observed for hemL gene expression Shao X, Zhang W, Umar MI, Wong HY, Seng Z, Xie Y, Zhang Y, Yang L, Kwok CK, Deng X,2020.
Reference(s): [1] Mizuno T., et al., 1983
Promoter
Name: ompFp
+1: 987092
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 110
Sequence: ctttatctttgtagcactttcacggtagcgaaacgttagtttgaatggaaagatgcctgcAgacacataaagacaccaaac
                               -35                    -10   +1                   
Note(s): Porin regulation by the CpxA-CpxR system and by the EnvZ-OmpR system converges at the porin promoters Batchelor E,2005.
The OmpR transcriptional factor cooperatively binds to the sites of the upstream regions from the ompFp promoter in a discontinuous galloping manner, as described by Yoshida T,2006
554 promoter regions from Escherichia coli were aligned in order to analyze their sequence similarities. Mitchell et al. (2003) Mitchell JE,2003 focused on conservation, patterns, similarities, and differences between promoters with or without an extended -10 5'-TG-3' element and other conserved elements. They experimentally showed that, for several naturally occurring extended -10 promoters, the 5'-TRTG-3' motif is an important determinant for promoter activity. Eleven promoters were selected for further experimental study. Of those, the seven most active (aroF > ompF > envA > purFp1 > purEF > purMN > gyrA) were investigated for the contribution of the extended -10 motif by changing the 5'-TG-3' motif. Promoters with poor matches to the -10 and -35 consensus hexamers are more dependent on the 5'-TG-3' motif, and this plays a similar role on different promoters. The dinucleotide at -17 and -16 in aroFp results in similar patterns of activity, suggesting that these bases play a similar role on different promoters Mitchell JE,2003.
Evidence: [COMP-AINF]
[EXP-IDA-TRANSCRIPTION-INIT-MAPPING]
[RS-EPT-CBR]
Reference(s): [2] Huerta AM., et al., 2003
[3] Inokuchi K., et al., 1984
[4] Salgado H, et al., 2012
Terminator(s)
Type: rho-independent
Sequence: gattgctctgGAAGGTATAAAAAAAACAGGACCAAAGTCCTGTTTTTTCGGCATTTAACAAAGAGgtgtgctatt
Reference(s): [12] Feng CQ., et al., 2019
[13] Lesnik EA., et al., 2001
TF binding sites (TFBSs)
[CRP,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal CRP-cyclic-AMP activator ompFp 987134 987155 -52.5 tttgaaaccaAATCTTTATCTTTGTAGCACTTtcacggtagc nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS] W [21]
proximal CRP-cyclic-AMP activator ompFp 987174 987195 -92.5 aagttccttaAATTTTACTTTTGGTTACATATtttttctttt nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS] W [21]
remote CRP-cyclic-AMP activator ompFp 987203 987224 -121.5 gtctctatggAAATATGACGGTGTTCACAAAGttccttaaat nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS] W [21]
[CpxR,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal CpxR-phosphorylated repressor ompFp 987153 987169 -68.5 acatatttttTCTTTTTGAAACCAAATctttatcttt nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [14], [15]
remote CpxR-phosphorylated repressor ompFp 987184 987185 -93.0 aattttacttTtggttacata nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [14], [15]
remote CpxR-phosphorylated repressor ompFp 987464 987465 -373.0 cctgttacggAatattacatt nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [14], [15]
remote CpxR-phosphorylated repressor ompFp 987514 987530 -429.5 ttttctgtcaAGTTATCTGTTTGTTAAgtcaagcaat nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [14], [15]
[EnvY,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd EnvY activator ompFp nd nd nd nd nd [EXP-IMP] W [33]
[Fur,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd Fur-Fe2+ activator ompFp nd nd nd nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS] W [21]
[IHF,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote IHF activator ompFp 987194 987206 -108.0 cggtgttcacAAAGTTCCTTAAAttttactttt nd [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-CELLULAR-EXTRACTS] nd nd
[IHF,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal IHF repressor ompFp 987148 987160 -62.0 ttctttttgaAACCAAATCTTTAtctttgtagc nd [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-CELLULAR-EXTRACTS] nd nd
remote IHF repressor ompFp 987262 987274 -176.0 aatataaggaAATCATATAAATAgattaaaatt nd [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-CELLULAR-EXTRACTS] nd nd
[OmpR,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal OmpR-phosphorylated activator ompFp 987133 987152 -50.5 gaaaccaaatCTTTATCTTTGTAGCACTTTcacggtagcg nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION] C [16], [18], [19], [20], [23], [24], [25], [26], [27], [28], [29], [30]
proximal OmpR-phosphorylated activator ompFp 987153 987172 -70.5 gttacatattTTTTCTTTTTGAAACCAAATctttatcttt nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-CELLULAR-EXTRACTS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION] C [17], [20], [23], [24], [25], [26], [27], [28], [29], [30], [31]
proximal OmpR-phosphorylated activator ompFp 987173 987192 -90.5 ttccttaaatTTTACTTTTGGTTACATATTttttcttttt nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION] C [20], [23], [24], [25], [26], [27], [28], [29]
[OmpR,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal OmpR-phosphorylated repressor ompFp 987133 987152 -50.5 gaaaccaaatCTTTATCTTTGTAGCACTTTcacggtagcg nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION] C [16], [18], [19], [20], [23], [24], [25], [26], [27], [28], [29], [30]
proximal OmpR-phosphorylated repressor ompFp 987153 987172 -70.5 gttacatattTTTTCTTTTTGAAACCAAATctttatcttt nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-CELLULAR-EXTRACTS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION] C [17], [20], [23], [24], [25], [26], [27], [28], [29], [30], [31]
remote OmpR-phosphorylated repressor ompFp 987453 987472 -370.5 cgatcatcctGTTACGGAATATTACATTGCaacatttacg nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [16], [17], [18], [19], [20]
[PhoB,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd PhoB-phosphorylated activator ompFp nd nd nd nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS] W [32]
[RstA,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal RstA-phosphorylated repressor ompFp 987176 987192 -92.0 ttccttaaatTTTACTTTTGGTTACATattttttctt nd [AS-NAS], [AS-NAS], [COMP-HINF-SIMILAR-TO-CONSENSUS] W [22]
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA RybB ompF repressor 987018 987042 GCCACUGCCGUCAAUAAGUUCUGUC nd [EXP-IEP], [EXP-IMP-SITE-MUTATION], [EXP-IPI] [5], [6]
small regulatory RNA MicF ompF repressor 986973 986998 GCUUCAUCAUUAUUUAUUACCCUCAU TRANSLATION-BLOCKING, MRNA-DEGRADATION [EXP-IDA], [EXP-IEP], [EXP-IMP], [EXP-IPI] [7], [8], [9], [10], [11]


Transcription unit          
Name: ompF
Synonym(s): OP00066
Gene(s): ompF   Genome Browser M3D Gene expression COLOMBOS
Note(s): It was proved in an experiment with increasing concentrations of the antibiotic tetracycline that the ompC gene is induced in low concentrations (1.5 and 4 mg/L), but not in high ones (10 mg/L) Viveiros M, Dupont M, Rodrigues L, Couto I, Davin-Regli A, Martins M, Pagès JM, Amaral L,2007 This result might be attributed to the constant increase during the experiment of micF gene expression, whose sRNA product negatively regulates the expression of the ompF gene Viveiros M, Dupont M, Rodrigues L, Couto I, Davin-Regli A, Martins M, Pagès JM, Amaral L,2007.
MarA and Rob independently regulate expression of the outer membrane porin F gene, ompF, in response to salicylate, activating micF gene expression in response to salicylate Chubiz LM, Rao CV,2011. In addition, MarA can also repress OmpF expression through a MicF-independent pathway Chubiz LM, Rao CV,2011. On the other hand, reduction in ompC expression in a tolC mutant was due primarily to Rob Chubiz LM, Rao CV,2011.
The expression of the gene ompF is increased under acidic growth conditions in either aerobiosis or microaerobiosis Marzan LW,2013 The increased expression under aerobiosis appears to be caused by the transcription factor PhoB Marzan LW,2013
Under NlpE outer membrane lipoprotein overexpression, the transcription of the ompF gene is decreased by CpxR Raivio TL,2013
A potential RNA G-quadruplex structure, formed by guanine-rich sequences located in the coding sequence region of the gene, was identified for ompF . This structure could regulate the expression of the gene, as observed for hemL gene expression Shao X, Zhang W, Umar MI, Wong HY, Seng Z, Xie Y, Zhang Y, Yang L, Kwok CK, Deng X,2020.
Reference(s): [1] Mizuno T., et al., 1983
Promoter
Name: ompFp2
+1: 987092
Sigma Factor: Sigma38 Sigmulon
Distance from start of the gene: 110
Sequence: ctttatctttgtagcactttcacggtagcgaaacgttagtttgaatggaaagatgcctgcAgacacataaagacaccaaac
Note(s): Porin regulation by the CpxA-CpxR system and by the EnvZ-OmpR system converges at the porin promoters Batchelor E,2005.
The OmpR transcriptional factor cooperatively binds to the sites of the upstream regions from the ompFp promoter in a discontinuous galloping manner, as described by Yoshida T,2006
554 promoter regions from Escherichia coli were aligned in order to analyze their sequence similarities. Mitchell et al. (2003) Mitchell JE,2003 focused on conservation, patterns, similarities, and differences between promoters with or without an extended -10 5'-TG-3' element and other conserved elements. They experimentally showed that, for several naturally occurring extended -10 promoters, the 5'-TRTG-3' motif is an important determinant for promoter activity. Eleven promoters were selected for further experimental study. Of those, the seven most active (aroF > ompF > envA > purFp1 > purEF > purMN > gyrA) were investigated for the contribution of the extended -10 motif by changing the 5'-TG-3' motif. Promoters with poor matches to the -10 and -35 consensus hexamers are more dependent on the 5'-TG-3' motif, and this plays a similar role on different promoters. The dinucleotide at -17 and -16 in aroFp results in similar patterns of activity, suggesting that these bases play a similar role on different promoters Mitchell JE,2003.
Evidence: [EXP-IDA-TRANSCRIPTION-INIT-MAPPING]
[EXP-IEP]
[RS-EPT-CBR]
Reference(s): [3] Inokuchi K., et al., 1984
[34] Lelong C., et al., 2007
[4] Salgado H, et al., 2012
Terminator(s)
Type: rho-independent
Sequence: gattgctctgGAAGGTATAAAAAAAACAGGACCAAAGTCCTGTTTTTTCGGCATTTAACAAAGAGgtgtgctatt
Reference(s): [12] Feng CQ., et al., 2019
[13] Lesnik EA., et al., 2001
TF binding sites (TFBSs)
[CRP,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal CRP-cyclic-AMP activator ompFp2 987134 987155 -52.5 tttgaaaccaAATCTTTATCTTTGTAGCACTTtcacggtagc nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS] W [21]
proximal CRP-cyclic-AMP activator ompFp2 987174 987195 -92.5 aagttccttaAATTTTACTTTTGGTTACATATtttttctttt nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS] W [21]
remote CRP-cyclic-AMP activator ompFp2 987203 987224 -121.5 gtctctatggAAATATGACGGTGTTCACAAAGttccttaaat nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS] W [21]
[CpxR,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal CpxR-phosphorylated repressor ompFp2 987153 987169 -68.5 acatatttttTCTTTTTGAAACCAAATctttatcttt nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [14], [15]
remote CpxR-phosphorylated repressor ompFp2 987184 987185 -93.0 aattttacttTtggttacata nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [14], [15]
remote CpxR-phosphorylated repressor ompFp2 987464 987465 -373.0 cctgttacggAatattacatt nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [14], [15]
remote CpxR-phosphorylated repressor ompFp2 987514 987530 -429.5 ttttctgtcaAGTTATCTGTTTGTTAAgtcaagcaat nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [14], [15]
[EnvY,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd EnvY activator ompFp2 nd nd nd nd nd [EXP-IMP] W [33]
[Fur,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd Fur-Fe2+ activator ompFp2 nd nd nd nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS] W [21]
[IHF,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote IHF activator ompFp2 987194 987206 -108.0 cggtgttcacAAAGTTCCTTAAAttttactttt nd [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-CELLULAR-EXTRACTS] nd nd
[IHF,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal IHF repressor ompFp2 987148 987160 -62.0 ttctttttgaAACCAAATCTTTAtctttgtagc nd [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-CELLULAR-EXTRACTS] nd nd
remote IHF repressor ompFp2 987262 987274 -176.0 aatataaggaAATCATATAAATAgattaaaatt nd [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-CELLULAR-EXTRACTS] nd nd
[OmpR,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal OmpR-phosphorylated activator ompFp2 987133 987152 -50.5 gaaaccaaatCTTTATCTTTGTAGCACTTTcacggtagcg nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION] C [16], [18], [19], [20], [23], [24], [25], [26], [27], [28], [29], [30]
proximal OmpR-phosphorylated activator ompFp2 987153 987172 -70.5 gttacatattTTTTCTTTTTGAAACCAAATctttatcttt nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-CELLULAR-EXTRACTS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION] C [17], [20], [23], [24], [25], [26], [27], [28], [29], [30], [31]
proximal OmpR-phosphorylated activator ompFp2 987173 987192 -90.5 ttccttaaatTTTACTTTTGGTTACATATTttttcttttt nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION] C [20], [23], [24], [25], [26], [27], [28], [29]
[OmpR,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal OmpR-phosphorylated repressor ompFp2 987133 987152 -50.5 gaaaccaaatCTTTATCTTTGTAGCACTTTcacggtagcg nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION] C [16], [18], [19], [20], [23], [24], [25], [26], [27], [28], [29], [30]
proximal OmpR-phosphorylated repressor ompFp2 987153 987172 -70.5 gttacatattTTTTCTTTTTGAAACCAAATctttatcttt nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-CELLULAR-EXTRACTS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION] C [17], [20], [23], [24], [25], [26], [27], [28], [29], [30], [31]
remote OmpR-phosphorylated repressor ompFp2 987453 987472 -370.5 cgatcatcctGTTACGGAATATTACATTGCaacatttacg nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [16], [17], [18], [19], [20]
[PhoB,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd PhoB-phosphorylated activator ompFp2 nd nd nd nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS] W [32]
[RstA,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal RstA-phosphorylated repressor ompFp2 987176 987192 -92.0 ttccttaaatTTTACTTTTGGTTACATattttttctt nd [AS-NAS], [AS-NAS], [COMP-HINF-SIMILAR-TO-CONSENSUS] W [22]
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA RybB ompF repressor 987018 987042 GCCACUGCCGUCAAUAAGUUCUGUC nd [EXP-IEP], [EXP-IMP-SITE-MUTATION], [EXP-IPI] [5], [6]
small regulatory RNA MicF ompF repressor 986973 986998 GCUUCAUCAUUAUUUAUUACCCUCAU TRANSLATION-BLOCKING [EXP-IDA], [EXP-IEP], [EXP-IPI] [7], [9], [10], [11]


Evidence    

 [COMP-AINF] Inferred computationally without human oversight

 [EXP-IDA-TRANSCRIPTION-INIT-MAPPING] Transcription initiation mapping

 [RS-EPT-CBR] RNA-seq using two enrichment strategies for primary transcripts and consistent biological replicates

 [EXP-IEP-GENE-EXPRESSION-ANALYSIS] Gene expression analysis

 [COMP-AINF-SIMILAR-TO-CONSENSUS] Automated inference based on similarity to consensus sequences

 [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] Binding of purified proteins

 [EXP-IMP] Inferred from mutant phenotype

 [COMP-HINF-SIMILAR-TO-CONSENSUS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [EXP-IDA-BINDING-OF-CELLULAR-EXTRACTS] Binding of cellular extracts

 [EXP-IMP-SITE-MUTATION] Site mutation

 [AS-NAS] Non-traceable author statement

 [EXP-IEP] Inferred from expression pattern

 [EXP-IPI] Inferred from physical interaction

 [EXP-IDA] Inferred from direct assay


Reference(s)    

 [1] Mizuno T., Chou MY., Inouye M., 1983, A comparative study on the genes for three porins of the Escherichia coli outer membrane. DNA sequence of the osmoregulated ompC gene., J Biol Chem 258(11):6932-40

 [2] Huerta AM., Collado-Vides J., 2003, Sigma70 promoters in Escherichia coli: specific transcription in dense regions of overlapping promoter-like signals., J Mol Biol 333(2):261-78

 [3] Inokuchi K., Furukawa H., Nakamura K., Mizushima S., 1984, Characterization by deletion mutagenesis in vitro of the promoter region of ompF, a positively regulated gene of Escherichia coli., J Mol Biol 178(3):653-68

 [4] Salgado H, Peralta-Gil M, Gama-Castro S, Santos-Zavaleta A, Muñiz-Rascado L, García-Sotelo JS, Weiss V, Solano-Lira H, Martínez-Flores I, Medina-Rivera A, Salgado-Osorio G, Alquicira-Hernández S, Alquicira-Hernández K, López-Fuentes A, Porrón-Sotelo L, Huerta AM, Bonavides-Martínez C, Balderas-Martínez YI, Pannier L, Olvera M, Labastida A, Jiménez-Jacinto V, Vega-Alvarado L, Del Moral-Chávez V, Hernández-Alvarez A, Morett E, Collado-Vides J., 2012, RegulonDB v8.0: omics data sets, evolutionary conservation, regulatory phrases, cross-validated gold standards and more., Nucleic Acids Res.

 [5] Gogol EB., Rhodius VA., Papenfort K., Vogel J., Gross CA., 2011, Small RNAs endow a transcriptional activator with essential repressor functions for single-tier control of a global stress regulon., Proc Natl Acad Sci U S A 108(31):12875-80

 [6] Lalaouna D., Carrier MC., Semsey S., Brouard JS., Wang J., Wade JT., Masse E., 2015, A 3' external transcribed spacer in a tRNA transcript acts as a sponge for small RNAs to prevent transcriptional noise., Mol Cell 58(3):393-405

 [7] Andersen J., Delihas N., 1990, micF RNA binds to the 5' end of ompF mRNA and to a protein from Escherichia coli., Biochemistry 29(39):9249-56

 [8] Chen J., To L., de Mets F., Luo X., Majdalani N., Tai CH., Gottesman S., 2021, A fluorescence-based genetic screen reveals diverse mechanisms silencing small RNA signaling in E. coli., Proc Natl Acad Sci U S A 118(27)

 [9] Mizuno T., Chou MY., Inouye M., 1984, A unique mechanism regulating gene expression: translational inhibition by a complementary RNA transcript (micRNA)., Proc Natl Acad Sci U S A 81(7):1966-70

 [10] Schmidt M., Zheng P., Delihas N., 1995, Secondary structures of Escherichia coli antisense micF RNA, the 5'-end of the target ompF mRNA, and the RNA/RNA duplex., Biochemistry 34(11):3621-31

 [11] Urban JH., Vogel J., 2007, Translational control and target recognition by Escherichia coli small RNAs in vivo., Nucleic Acids Res 35(3):1018-37

 [12] Feng CQ., Zhang ZY., Zhu XJ., Lin Y., Chen W., Tang H., Lin H., 2019, iTerm-PseKNC: a sequence-based tool for predicting bacterial transcriptional terminators., Bioinformatics 35(9):1469-1477

 [13] Lesnik EA., Sampath R., Levene HB., Henderson TJ., McNeil JA., Ecker DJ., 2001, Prediction of rho-independent transcriptional terminators in Escherichia coli., Nucleic Acids Res 29(17):3583-94

 [14] Batchelor E., Walthers D., Kenney LJ., Goulian M., 2005, The Escherichia coli CpxA-CpxR envelope stress response system regulates expression of the porins ompF and ompC., J Bacteriol 187(16):5723-31

 [15] Raivio TL., Leblanc SK., Price NL., 2013, The Escherichia coli Cpx envelope stress response regulates genes of diverse function that impact antibiotic resistance and membrane integrity., J Bacteriol 195(12):2755-67

 [16] Huang KJ., Schieberl JL., Igo MM., 1994, A distant upstream site involved in the negative regulation of the Escherichia coli ompF gene., J Bacteriol 176(5):1309-15

 [17] Oshima T., Aiba H., Masuda Y., Kanaya S., Sugiura M., Wanner BL., Mori H., Mizuno T., 2002, Transcriptome analysis of all two-component regulatory system mutants of Escherichia coli K-12., Mol Microbiol 46(1):281-91

 [18] Rampersaud A., Harlocker SL., Inouye M., 1994, The OmpR protein of Escherichia coli binds to sites in the ompF promoter region in a hierarchical manner determined by its degree of phosphorylation., J Biol Chem 269(17):12559-66

 [19] Slauch JM., Silhavy TJ., 1991, cis-acting ompF mutations that result in OmpR-dependent constitutive expression., J Bacteriol 173(13):4039-48

 [20] Yoshida T., Qin L., Egger LA., Inouye M., 2006, Transcription regulation of ompF and ompC by a single transcription factor, OmpR., J Biol Chem 281(25):17114-23

 [21] Zhang Z., Gosset G., Barabote R., Gonzalez CS., Cuevas WA., Saier MH., 2005, Functional interactions between the carbon and iron utilization regulators, Crp and Fur, in Escherichia coli., J Bacteriol 187(3):980-90

 [22] Ogasawara H., Hasegawa A., Kanda E., Miki T., Yamamoto K., Ishihama A., 2007, Genomic SELEX search for target promoters under the control of the PhoQP-RstBA signal relay cascade., J Bacteriol 189(13):4791-9

 [23] Forst SA., Delgado J., Inouye M., 1989, DNA-binding properties of the transcription activator (OmpR) for the upstream sequences of ompF in Escherichia coli are altered by envZ mutations and medium osmolarity., J Bacteriol 171(6):2949-55

 [24] Lan CY., Igo MM., 1998, Differential expression of the OmpF and OmpC porin proteins in Escherichia coli K-12 depends upon the level of active OmpR., J Bacteriol 180(1):171-4

 [25] Mattison K., Oropeza R., Byers N., Kenney LJ., 2002, A phosphorylation site mutant of OmpR reveals different binding conformations at ompF and ompC., J Mol Biol 315(4):497-511

 [26] Qin L., Yoshida T., Inouye M., 2001, The critical role of DNA in the equilibrium between OmpR and phosphorylated OmpR mediated by EnvZ in Escherichia coli., Proc Natl Acad Sci U S A 98(3):908-13

 [27] Rampersaud A., Norioka S., Inouye M., 1989, Characterization of OmpR binding sequences in the upstream region of the ompF promoter essential for transcriptional activation., J Biol Chem 264(31):18693-700

 [28] Sato M., Machida K., Arikado E., Saito H., Kakegawa T., Kobayashi H., 2000, Expression of outer membrane proteins in Escherichia coli growing at acid pH., Appl Environ Microbiol 66(3):943-7

 [29] Tsung K., Brissette RE., Inouye M., 1989, Identification of the DNA-binding domain of the OmpR protein required for transcriptional activation of the ompF and ompC genes of Escherichia coli by in vivo DNA footprinting., J Biol Chem 264(17):10104-9

 [30] Forst S., Kalve I., Durski W., 1995, Molecular analysis of OmpR binding sequences involved in the regulation of ompF in Escherichia coli., FEMS Microbiol Lett 131(2):147-51

 [31] Ramani N., Huang L., Freundlich M., 1992, In vitro interactions of integration host factor with the ompF promoter-regulatory region of Escherichia coli., Mol Gen Genet 231(2):248-55

 [32] Marzan LW., Hasan CM., Shimizu K., 2013, Effect of acidic condition on the metabolic regulation of Escherichia coli and its phoB mutant., Arch Microbiol 195(3):161-71

 [33] Lundrigan MD., Earhart CF., 1984, Gene envY of Escherichia coli K-12 affects thermoregulation of major porin expression., J Bacteriol 157(1):262-8

 [34] Lelong C., Aguiluz K., Luche S., Kuhn L., Garin J., Rabilloud T., Geiselmann J., 2007, The Crl-RpoS regulon of Escherichia coli., Mol Cell Proteomics 6(4):648-59

RegulonDB