RegulonDB RegulonDB 11.1: Operon Form
   

sodA operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: sodA
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: sodA
Synonym(s): OP00089
Gene(s): sodA   Genome Browser M3D Gene expression COLOMBOS
Note(s): The expression of the sodA gene is induced quickly under oxidative stress Lu C,2003as a result of the inactivation of its transcriptional repressor, Fur Varghese S, Wu A, Park S, Imlay KR, Imlay JA,2007 The expression of this gene is also increased under acidic growth conditions in either aerobiosis or microaerobiosis Marzan LW,2013
Under nitrogen-rich growth conditions, the expression of the sodA gene increased in mutants for two genes that encode two terminal oxidases, cyoA and cydB, and in mutants for two transcriptional regulators, Fnr and Fur. However, under nitrogen-limited growth conditions, gene expression was decreased in the Fnr mutant Kumar R,2011
The transcription of the gene sodA is enhanced under high oxygen saturation (300%) Baez A,2013
Hepcidin, an antimicrobial peptide, increases the expression of sodA under conditions of iron availability Pascoe MJ, Lueangsakulthai J, Ripley D, Morris RH, Maddocks SE,2018
Evidence: [EXP-IDA-BOUNDARIES-DEFINED] Boundaries of transcription experimentally identified
Reference(s): [1] Takeda Y., et al., 1986
Promoter
Name: sodAp
+1: 4100759
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 51
Sequence: tacgaaaagtacggcattgataatcattttcaatatcatttaattaactataatgaaccaActgcttacgcggcattaaca
                            -35                  -10        +1                   
Note(s): The activity of this promoter appears to be decreased in the presence of σE. It is repressed during the first 5 minutes following σE induction and decreased from 5 to 10 minutes and from 10 to 20 minutes after induction of the σ factor Lacoux C,2020.
Evidence: [COMP-AINF]
[COMP-HINF]
[COMP-HINF-POSITIONAL-IDENTIFICATION]
[EXP-IDA-TRANSCRIPTION-INIT-MAPPING]
[RS-EPT-CBR]
Reference(s): [2] Huerta AM., et al., 2003
[3] Salgado H, et al., 2012
[1] Takeda Y., et al., 1986
Terminator(s)
Type: rho-independent
Sequence: tataggccgcATATCAGCTTAAAAAATGAACCATCGCCAACGGCGGTGGTTTTTTTGTGATCAATttcaaaataa
Reference(s): [6] Feng CQ., et al., 2019
[7] Lesnik EA., et al., 2001
TF binding sites (TFBSs)
[ArcA,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal ArcA-phosphorylated repressor sodAp 4100714 4100728 -38.0 aaagtacggcATTGATAATCATTTTcaatatcatt nd [EXP-IDA-BINDING-OF-CELLULAR-EXTRACTS] nd [20]
proximal ArcA-phosphorylated repressor sodAp 4100731 4100745 -21.0 atcattttcaATATCATTTAATTAActataatgaa nd [COMP-AINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-CELLULAR-EXTRACTS] nd [20]
proximal ArcA-phosphorylated repressor sodAp 4100742 4100756 -10.0 tatcatttaaTTAACTATAATGAACcaactgctta nd [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-CELLULAR-EXTRACTS] nd [20]
[CRP,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote CRP-cyclic-AMP activator sodAp 4100649 4100671 -99.5 acggcattaaGTGGGTGATTTGCTTCACATCTCgggcattttc nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS] W [8], [9], [10]
[FNR,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal FNR repressor sodAp 4100715 4100728 -37.5 aagtacggcaTTGATAATCATTTTcaatatcatt nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-CELLULAR-EXTRACTS] W [16], [21], [22]
[Fur,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal Fur-Fe2+ repressor sodAp 4100708 4100726 -42.0 ttacgaaaagTACGGCATTGATAATCATTttcaatatca nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-CELLULAR-EXTRACTS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] C [15], [16]
proximal Fur-Fe2+ repressor sodAp 4100714 4100732 -36.0 aaagtacggcATTGATAATCATTTTCAATatcatttaat nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-CELLULAR-EXTRACTS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] C [15], [16]
proximal Fur-Fe2+ repressor sodAp 4100717 4100735 -33.0 gtacggcattGATAATCATTTTCAATATCatttaattaa nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-CELLULAR-EXTRACTS] S [16], [23]
proximal Fur-Fe2+ repressor sodAp 4100720 4100738 -30.0 cggcattgatAATCATTTTCAATATCATTtaattaacta nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [15], [16]
[IHF,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal IHF repressor sodAp 4100685 4100697 -68.0 cattttcctgCAAAACCATACCCttacgaaaag nd [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] nd nd
proximal IHF repressor sodAp 4100705 4100717 -48.0 cccttacgaaAAGTACGGCATTGataatcattt nd [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] nd nd
proximal IHF repressor sodAp 4100729 4100741 -24.0 taatcattttCAATATCATTTAAttaactataa nd [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] nd nd
proximal IHF repressor sodAp 4100752 4100764 -1.0 ttaactataaTGAACCAACTGCTtacgcggcat nd [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] nd nd
[MarA,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal MarA activator sodAp 4100709 4100728 -40.5 tacgaaaagtACGGCATTGATAATCATTTTcaatatcatt nd [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] nd [12], [17], [18]
[Rob,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal Rob activator sodAp 4100709 4100728 -40.5 tacgaaaagtACGGCATTGATAATCATTTTcaatatcatt nd [COMP-HINF-SIMILAR-TO-CONSENSUS] nd [19]
[SoxR,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal SoxR activator sodAp 4100758 4100775 9.0 ataatgaaccAACTGCTTACGCGGCATTaacaatcggc nd [EXP-IEP-RNA-SEQ], [COMP-HINF], [EXP-CHIP-EXO-MANUAL] S [14]
[SoxS,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal SoxS activator sodAp 4100705 4100724 -44.0 cccttacgaaAAGTACGGCATTGATAATCAttttcaatat nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IEP-RNA-SEQ], [COMP-HINF], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-CHIP-EXO-MANUAL], [EXP-IDA-BINDING-OF-CELLULAR-EXTRACTS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] C [11], [12], [13], [14]
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA FnrS sodA repressor 4100791 4100825 GACAAUACUGGAGAUGAAUAUGAGCUAUACCCUGC nd [EXP-IDA], [EXP-IEP] [4]
small regulatory RNA RyhB sodA repressor 4100794 4100815 AAUACUGGAGAUGAAUAUGAGC nd [EXP-IEP] [5]


RNA cis-regulatory element    
Regulation, transcriptional elongation  
Attenuator type: Translational
Strand: forward
  Structure type Energy LeftPos RightPos Sequence (RNA-strand)
  terminator -7.3 4100768 4100788 actgcttacgCGGCATTAACAATCGGCCGCccgacaatac
Notes: "The provided "Sequence" is that of the RNA strand, i.e. U's are shown instead of T's and regulators on the reverse strand will appear as the reverse complement of the sequence delimited by LeftPos-RigtPos"


Evidence    

 [COMP-AINF] Inferred computationally without human oversight

 [COMP-HINF] Inferred by a human based on computational evidence

 [COMP-HINF-POSITIONAL-IDENTIFICATION] Human inference of promoter position

 [EXP-IDA-TRANSCRIPTION-INIT-MAPPING] Transcription initiation mapping

 [RS-EPT-CBR] RNA-seq using two enrichment strategies for primary transcripts and consistent biological replicates

 [EXP-IDA-BINDING-OF-CELLULAR-EXTRACTS] Binding of cellular extracts

 [COMP-AINF-SIMILAR-TO-CONSENSUS] Automated inference based on similarity to consensus sequences

 [COMP-HINF-SIMILAR-TO-CONSENSUS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [EXP-IEP-GENE-EXPRESSION-ANALYSIS] Gene expression analysis

 [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] Binding of purified proteins

 [EXP-IEP-RNA-SEQ] high throughput RNA-seq evidence

 [EXP-CHIP-EXO-MANUAL] ChIP-exo evidence used in manual assertion

 [EXP-IDA] Inferred from direct assay

 [EXP-IEP] Inferred from expression pattern


Reference(s)    

 [1] Takeda Y., Avila H., 1986, Structure and gene expression of the E. coli Mn-superoxide dismutase gene., Nucleic Acids Res 14(11):4577-89

 [2] Huerta AM., Collado-Vides J., 2003, Sigma70 promoters in Escherichia coli: specific transcription in dense regions of overlapping promoter-like signals., J Mol Biol 333(2):261-78

 [3] Salgado H, Peralta-Gil M, Gama-Castro S, Santos-Zavaleta A, Muñiz-Rascado L, García-Sotelo JS, Weiss V, Solano-Lira H, Martínez-Flores I, Medina-Rivera A, Salgado-Osorio G, Alquicira-Hernández S, Alquicira-Hernández K, López-Fuentes A, Porrón-Sotelo L, Huerta AM, Bonavides-Martínez C, Balderas-Martínez YI, Pannier L, Olvera M, Labastida A, Jiménez-Jacinto V, Vega-Alvarado L, Del Moral-Chávez V, Hernández-Alvarez A, Morett E, Collado-Vides J., 2012, RegulonDB v8.0: omics data sets, evolutionary conservation, regulatory phrases, cross-validated gold standards and more., Nucleic Acids Res.

 [4] Boysen A., Moller-Jensen J., Kallipolitis B., Valentin-Hansen P., Overgaard M., 2010, Translational regulation of gene expression by an anaerobically induced small non-coding RNA in Escherichia coli., J Biol Chem 285(14):10690-702

 [5] Argaman L., Elgrably-Weiss M., Hershko T., Vogel J., Altuvia S., 2012, RelA protein stimulates the activity of RyhB small RNA by acting on RNA-binding protein Hfq., Proc Natl Acad Sci U S A 109(12):4621-6

 [6] Feng CQ., Zhang ZY., Zhu XJ., Lin Y., Chen W., Tang H., Lin H., 2019, iTerm-PseKNC: a sequence-based tool for predicting bacterial transcriptional terminators., Bioinformatics 35(9):1469-1477

 [7] Lesnik EA., Sampath R., Levene HB., Henderson TJ., McNeil JA., Ecker DJ., 2001, Prediction of rho-independent transcriptional terminators in Escherichia coli., Nucleic Acids Res 29(17):3583-94

 [8] Tsai MJ., Wang JR., Yang CD., Kao KC., Huang WL., Huang HY., Tseng CP., Huang HD., Ho SY., 2018, PredCRP: predicting and analysing the regulatory roles of CRP from its binding sites in Escherichia coli., Sci Rep 8(1):951

 [9] Via P., Badia J., Baldoma L., Obradors N., Aguilar J., 1996, Transcriptional regulation of the Escherichia coli rhaT gene., Microbiology 142 ( Pt 7):1833-40

 [10] Zheng D., Constantinidou C., Hobman JL., Minchin SD., 2004, Identification of the CRP regulon using in vitro and in vivo transcriptional profiling., Nucleic Acids Res 32(19):5874-93

 [11] Jair KW., Fawcett WP., Fujita N., Ishihama A., Wolf RE., 1996, Ambidextrous transcriptional activation by SoxS: requirement for the C-terminal domain of the RNA polymerase alpha subunit in a subset of Escherichia coli superoxide-inducible genes., Mol Microbiol 19(2):307-17

 [12] Martin RG., Rosner JL., 2011, Promoter discrimination at class I MarA regulon promoters mediated by glutamic acid 89 of the MarA transcriptional activator of Escherichia coli., J Bacteriol 193(2):506-15

 [13] Pomposiello PJ., Bennik MH., Demple B., 2001, Genome-wide transcriptional profiling of the Escherichia coli responses to superoxide stress and sodium salicylate., J Bacteriol 183(13):3890-902

 [14] Seo SW., Kim D., Szubin R., Palsson BO., 2015, Genome-wide Reconstruction of OxyR and SoxRS Transcriptional Regulatory Networks under Oxidative Stress in Escherichia coli K-12 MG1655., Cell Rep 12(8):1289-99

 [15] Chen Z., Lewis KA., Shultzaberger RK., Lyakhov IG., Zheng M., Doan B., Storz G., Schneider TD., 2007, Discovery of Fur binding site clusters in Escherichia coli by information theory models., Nucleic Acids Res 35(20):6762-77

 [16] Kumar R., Shimizu K., 2011, Transcriptional regulation of main metabolic pathways of cyoA, cydB, fnr, and fur gene knockout Escherichia coli in C-limited and N-limited aerobic continuous cultures., Microb Cell Fact 10:3

 [17] Jair KW., Martin RG., Rosner JL., Fujita N., Ishihama A., Wolf RE., 1995, Purification and regulatory properties of MarA protein, a transcriptional activator of Escherichia coli multiple antibiotic and superoxide resistance promoters., J Bacteriol 177(24):7100-4

 [18] Martin RG., Gillette WK., Rhee S., Rosner JL., 1999, Structural requirements for marbox function in transcriptional activation of mar/sox/rob regulon promoters in Escherichia coli: sequence, orientation and spatial relationship to the core promoter., Mol Microbiol 34(3):431-41

 [19] Ariza RR., Li Z., Ringstad N., Demple B., 1995, Activation of multiple antibiotic resistance and binding of stress-inducible promoters by Escherichia coli Rob protein., J Bacteriol 177(7):1655-61

 [20] Tardat B., Touati D., 1993, Iron and oxygen regulation of Escherichia coli MnSOD expression: competition between the global regulators Fur and ArcA for binding to DNA., Mol Microbiol 9(1):53-63

 [21] Hassan HM., Sun HC., 1992, Regulatory roles of Fnr, Fur, and Arc in expression of manganese-containing superoxide dismutase in Escherichia coli., Proc Natl Acad Sci U S A 89(8):3217-21

 [22] Iuchi S., Aristarkhov A., Dong JM., Taylor JS., Lin EC., 1994, Effects of nitrate respiration on expression of the Arc-controlled operons encoding succinate dehydrogenase and flavin-linked L-lactate dehydrogenase., J Bacteriol 176(6):1695-701

 [23] Niederhoffer EC., Naranjo CM., Bradley KL., Fee JA., 1990, Control of Escherichia coli superoxide dismutase (sodA and sodB) genes by the ferric uptake regulation (fur) locus., J Bacteriol 172(4):1930-8

RegulonDB