RegulonDB RegulonDB 11.2: Operon Form
   

hns operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: hns
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: hns
Synonym(s): OP00190
Gene(s): hns   Genome Browser M3D Gene expression COLOMBOS
Note(s): J. Oberto in 2010 identified a possible binding site for NagC, ATTTATTGGCGGCACAAAATAAA, in the intergenic region of the divergent genes tdk and hns. This demonstration was based on different statistical methods Oberto J.,2010 but it is not known if NagC regulates transcription in both directions.
The expression of the gene hns is increased under acidic growth conditions in microaerobiosis Marzan LW,2013
H-NS, through its genome position, affects its own transcription activity, which is dependent on the growth phase and the growth rate of the cells Brambilla E, Sclavi B,2015 This is the first evidence for modulation of gene expression dependent on the chromosomal position of a global regulator. Genomic position plays a significant role in the adaptation of cells to environmental changes Brambilla E, Sclavi B,2015
Reference(s): [1] Ueguchi C., et al., 1993
Promoter
Name: hnsp
+1: 1292958
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 36
Sequence: tttgaattccttacattcctggctattgcacaactgaatttaaggctctattattacctcAacaaaccaccccaatataag
                               -35                    -10   +1                   
Evidence: [COMP-AINF]
[EXP-IDA-HPT-TRANSCR-INIT-M-RACE-MAP]
[EXP-IDA-TRANSCRIPTION-INIT-MAPPING]
[RS-EPT-CBR]
Reference(s): [2] Dersch P., et al., 1993
[3] Huerta AM., et al., 2003
[4] La Teana A., et al., 1989
[5] Mendoza-Vargas A., et al., 2009
[6] Salgado H, et al., 2012
Terminator(s)
Type: rho-independent
Sequence: cggacaataaAAAATCCCGCCGCTGGCGGGATTTTaagcaagtgc
Reference(s): [10] Chib S., et al., 2012
TF binding sites (TFBSs)
[CspA,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd CspA activator hnsp nd nd nd nd nd [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] nd [14]
[Fis,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal Fis activator hnsp 1292927 1292941 25.0 caccccaataTAAGTTTGAGATTACtacaatgagc nd [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] nd [11]
proximal Fis activator hnsp 1292961 1292975 -10.0 ctgaatttaaGGCTCTATTATTACCtcaacaaacc nd [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] nd [11]
proximal Fis activator hnsp 1293022 1293036 -71.0 ttattggcggCACAAAATAAAGAACaattttgaat nd [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] nd [11]
remote Fis activator hnsp 1293069 1293083 -118.0 tagggctataTGCCGCGTCTTTTCTggctaatttt nd [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] nd [11]
remote Fis activator hnsp 1293125 1293139 -174.0 atgtgacatgAATCAGGAAGTTTTAacctcacgtg nd [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] nd [11]
remote Fis activator hnsp 1293194 1293208 -243.0 ggaattctcgTAAACACAACTAATAcagaagactg nd [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] nd [11]
remote Fis activator hnsp 1293233 1293247 -282.0 ttattgcgacTGTTCTACTTTTCATcattcgctta nd [EXP-CHIP-EXO], [EXP-CHIP-SEQ], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] nd [11]
[GadX,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd GadX activator hnsp nd nd nd nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS] W [13]
[H-NS,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal H-NS repressor hnsp 1292991 1293005 -40.0 gaattccttaCATTCCTGGCTATTGcacaactgaa nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-CHIP-SEQ], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] C [1], [11]
remote H-NS repressor hnsp 1293064 1293078 -113.0 ctatatgccgCGTCTTTTCTGGCTAattttatgaa nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-CHIP-SEQ], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [1], [11], [12]
remote H-NS repressor hnsp 1293133 1293147 -182.0 cccataaaatGTGACATGAATCAGGaagttttaac nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-CHIP-SEQ], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [1], [11], [12]
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA DsrA hns repressor 1292904 1292916 UUUUAAGUGCUUC MRNA-DEGRADATION [EXP-IEP], [EXP-IMP-SITE-MUTATION] [7], [8], [9]
Allosteric regulation of RNA-polymerase
  Regulator Function Promoter target of RNApol Growth Conditions Note Evidence Reference
  ppGpp inhibition hnsp nd   [EXP-IDA-PURIFIED-PROTEIN]
[EXP-IEP-GENE-EXPRESSION-ANALYSIS] 		[15]
Evidence: [EXP-IDA-PURIFIED-PROTEIN] Assay of protein purified to homogeneity
[EXP-IEP-GENE-EXPRESSION-ANALYSIS] Gene expression analysis
Reference(s): [15] Brandi A., et al., 2020


Evidence    

 [COMP-AINF] Inferred computationally without human oversight

 [EXP-IDA-HPT-TRANSCR-INIT-M-RACE-MAP] High-throughput transcription initiation mapping

 [EXP-IDA-TRANSCRIPTION-INIT-MAPPING] Transcription initiation mapping

 [RS-EPT-CBR] RNA-seq using two enrichment strategies for primary transcripts and consistent biological replicates

 [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] Binding of purified proteins

 [EXP-CHIP-EXO] high throughput ChIP-exo evidence

 [EXP-CHIP-SEQ] high throughput ChIP-seq evidence

 [EXP-IEP-GENE-EXPRESSION-ANALYSIS] Gene expression analysis

 [COMP-HINF-SIMILAR-TO-CONSENSUS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [EXP-IEP] Inferred from expression pattern

 [EXP-IMP-SITE-MUTATION] Site mutation


Reference(s)    

 [1] Ueguchi C., Kakeda M., Mizuno T., 1993, Autoregulatory expression of the Escherichia coli hns gene encoding a nucleoid protein: H-NS functions as a repressor of its own transcription., Mol Gen Genet 236(2-3):171-8

 [2] Dersch P., Schmidt K., Bremer E., 1993, Synthesis of the Escherichia coli K-12 nucleoid-associated DNA-binding protein H-NS is subjected to growth-phase control and autoregulation., Mol Microbiol 8(5):875-89

 [3] Huerta AM., Collado-Vides J., 2003, Sigma70 promoters in Escherichia coli: specific transcription in dense regions of overlapping promoter-like signals., J Mol Biol 333(2):261-78

 [4] La Teana A., Falconi M., Scarlato V., Lammi M., Pon CL., 1989, Characterization of the structural genes for the DNA-binding protein H-NS in Enterobacteriaceae., FEBS Lett 244(1):34-8

 [5] Mendoza-Vargas A., Olvera L., Olvera M., Grande R., Vega-Alvarado L., Taboada B., Jimenez-Jacinto V., Salgado H., Juarez K., Contreras-Moreira B., Huerta AM., Collado-Vides J., Morett E., 2009, Genome-wide identification of transcription start sites, promoters and transcription factor binding sites in E. coli., PLoS One 4(10):e7526

 [6] Salgado H, Peralta-Gil M, Gama-Castro S, Santos-Zavaleta A, Muñiz-Rascado L, García-Sotelo JS, Weiss V, Solano-Lira H, Martínez-Flores I, Medina-Rivera A, Salgado-Osorio G, Alquicira-Hernández S, Alquicira-Hernández K, López-Fuentes A, Porrón-Sotelo L, Huerta AM, Bonavides-Martínez C, Balderas-Martínez YI, Pannier L, Olvera M, Labastida A, Jiménez-Jacinto V, Vega-Alvarado L, Del Moral-Chávez V, Hernández-Alvarez A, Morett E, Collado-Vides J., 2012, RegulonDB v8.0: omics data sets, evolutionary conservation, regulatory phrases, cross-validated gold standards and more., Nucleic Acids Res.

 [7] Lease RA., Belfort M., 2000, A trans-acting RNA as a control switch in Escherichia coli: DsrA modulates function by forming alternative structures., Proc Natl Acad Sci U S A 97(18):9919-24

 [8] Lease RA., Cusick ME., Belfort M., 1998, Riboregulation in Escherichia coli: DsrA RNA acts by RNA:RNA interactions at multiple loci., Proc Natl Acad Sci U S A 95(21):12456-61

 [9] Parker A., Cureoglu S., De Lay N., Majdalani N., Gottesman S., 2017, Alternative pathways for Escherichia coli biofilm formation revealed by sRNA overproduction., Mol Microbiol 105(2):309-325

 [10] Chib S., Mahadevan S., 2012, Involvement of the Global Regulator H-NS in the Survival of Escherichia coli in Stationary Phase., J Bacteriol 194(19):5285-93

 [11] Falconi M., Brandi A., La Teana A., Gualerzi CO., Pon CL., 1996, Antagonistic involvement of FIS and H-NS proteins in the transcriptional control of hns expression., Mol Microbiol 19(5):965-75

 [12] Falconi M., Higgins NP., Spurio R., Pon CL., Gualerzi CO., 1993, Expression of the gene encoding the major bacterial nucleotide protein H-NS is subject to transcriptional auto-repression., Mol Microbiol 10(2):273-82

 [13] Hommais F., Krin E., Coppee JY., Lacroix C., Yeramian E., Danchin A., Bertin P., 2004, GadE (YhiE): a novel activator involved in the response to acid environment in Escherichia coli., Microbiology 150(Pt 1):61-72

 [14] Giangrossi M., Gualerzi CO., Pon CL., 2001, Mutagenesis of the downstream region of the Escherichia coli hns promoter., Biochimie 83(2):251-9

 [15] Brandi A., Giangrossi M., Fabbretti A., Falconi M., 2020, The hns Gene of Escherichia coli Is Transcriptionally Down-Regulated by (p)ppGpp., Microorganisms 8(10)

RegulonDB