RegulonDB RegulonDB 11.1: Operon Form
   

metE operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: metE
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: metE
Gene(s): metE   Genome Browser M3D Gene expression COLOMBOS
Note(s): In 1989 Urbanowski et al. proposed that, in Salmonella typhimurium, MetR binds to a region of 13 bp (TGAAnnnnnTTCA) Urbanowski ML, Stauffer GV,1989 in the regulatory region located between the divergent genes metE and metR. More recently, Wu et al. showed, in S. typhimurium, that this regulator binds as dimer of dimers in the same region of regulation Lorenz E,1995.
The central positions of the MetR binding sites in Escherichia coli have been assigned according to the consensus sequence obtained for S. typhimurium (TGAAnnnnnTTCA). Using a new methodology based on analysis of orthologous sequences, the curator has identified the consensus sequence of MetR (aTGAAaaattTTCAt) of 15 bp, which is similar to the consensus sequence identified in the RegPrecise database (aTGAAaTcaaTTCAt). According to this information, the curator assigned two possible binding sites for MetR, located at bp -41 and -62 of the transcription start site of metE.
Promoter
Name: metEp
+1: 4012884
Distance from start of the gene: 169
Sequence: cttcacttcggcatgaataatttgcgcttgaggaatatacagtaaccgccaattatggatGtgtaaacatctggacggcta
Evidence: [EXP-IDA-TRANSCRIPTION-INIT-MAPPING]
Reference(s): [1] Cai XY., et al., 1989
TF binding sites (TFBSs)
[MetJ,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal MetJ-S-adenosyl-L-methionine repressor metEp 4012877 4012892 1.5 aaccgccaatTATGGATGTGTAAACAtctggacggc nd [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] nd [1]
remote MetJ-S-adenosyl-L-methionine repressor metEp 4012992 4013007 116.5 ggatgaataaACTTGCCGCCTTCCCTaaattcaaaa nd [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] nd [1]
[MetR,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal MetR-L-homocysteine activator metEp 4012815 4012829 -62.0 tacttcgatcATGAAAGTCCTTCACttcggcatga nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [1], [3], [4], [5]
proximal MetR-L-homocysteine activator metEp 4012836 4012850 -41.0 tcacttcggcATGAATAATTTGCGCttgaggaata nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [1], [3], [4], [5]
[OxyR,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal OxyR activator metEp 4012834 4012850 -42.0 cttcacttcgGCATGAATAATTTGCGCttgaggaata nd [EXP-IEP-RNA-SEQ], [COMP-HINF], [EXP-CHIP-EXO-MANUAL] S [6]
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA FnrS metE repressor 4013035 4013065 UAAUUAGAGGAAGAAAAAAUGACAAUAUUGA nd [EXP-IEP] [2]


Evidence    

 [EXP-IDA-TRANSCRIPTION-INIT-MAPPING] Transcription initiation mapping

 [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] Binding of purified proteins

 [EXP-IEP-GENE-EXPRESSION-ANALYSIS] Gene expression analysis

 [COMP-HINF-SIMILAR-TO-CONSENSUS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [EXP-IEP-RNA-SEQ] RNA-seq evidence

 [COMP-HINF] Inferred by a human based on computational evidence

 [EXP-CHIP-EXO-MANUAL] ChIP-exo evidence used in manual assertion

 [EXP-IEP] Inferred from expression pattern


Reference(s)    

 [1] Cai XY., Maxon ME., Redfield B., Glass R., Brot N., Weissbach H., 1989, Methionine synthesis in Escherichia coli: effect of the MetR protein on metE and metH expression., Proc Natl Acad Sci U S A 86(12):4407-11

 [2] Boysen A., Moller-Jensen J., Kallipolitis B., Valentin-Hansen P., Overgaard M., 2010, Translational regulation of gene expression by an anaerobically induced small non-coding RNA in Escherichia coli., J Biol Chem 285(14):10690-702

 [3] Cai XY., Redfield B., Maxon M., Weissbach H., Brot N., 1989, The effect of homocysteine on MetR regulation of metE, metR and metH expression in vitro., Biochem Biophys Res Commun 163(1):79-83

 [4] Jafri S., Urbanowski ML., Stauffer GV., 1995, A mutation in the rpoA gene encoding the alpha subunit of RNA polymerase that affects metE-metR transcription in Escherichia coli., J Bacteriol 177(3):524-9

 [5] Maxon ME., Redfield B., Cai XY., Shoeman R., Fujita K., Fisher W., Stauffer G., Weissbach H., Brot N., 1989, Regulation of methionine synthesis in Escherichia coli: effect of the MetR protein on the expression of the metE and metR genes., Proc Natl Acad Sci U S A 86(1):85-9

 [6] Seo SW., Kim D., Szubin R., Palsson BO., 2015, Genome-wide Reconstruction of OxyR and SoxRS Transcriptional Regulatory Networks under Oxidative Stress in Escherichia coli K-12 MG1655., Cell Rep 12(8):1289-99

RegulonDB