RegulonDB RegulonDB 10.9: Operon Form

metE operon and associated TUs in Escherichia coli K-12 genome

Name: metE
This page displays every known transcription unit of this operon and their known regulation.

Transcription unit          
Name: metE
Gene(s): metE   Genome Browser M3D Gene expression COLOMBOS
Note(s): In 1989 Urbanowski et al. proposed that, in Salmonella typhimurium, MetR binds to a region of 13 bp (TGAAnnnnnTTCA) 2676984 in the regulatory region located between the divergent genes metE and metR. More recently, Wu et al. showed, in S. typhimurium, that this regulator binds as dimer of dimers in the same region of regulation Lorenz E,1995.
The central positions of the MetR binding sites in Escherichia coli have been assigned according to the consensus sequence obtained for S. typhimurium (TGAAnnnnnTTCA). Using a new methodology based on analysis of orthologous sequences, the curator has identified the consensus sequence of MetR (aTGAAaaattTTCAt) of 15 bp, which is similar to the consensus sequence identified in the RegPrecise database (aTGAAaTcaaTTCAt). According to this information, the curator assigned two possible binding sites for MetR, located at bp -41 and -62 of the transcription start site of metE.
Name: metEp
+1: 4012884
Distance from start of the gene: 169
Sequence: cttcacttcggcatgaataatttgcgcttgaggaatatacagtaaccgccaattatggatGtgtaaacatctggacggcta
Evidence: [TIM]
Reference(s): [1] Cai XY., et al., 1989
TF binding sites (TFBSs)
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal MetJ-S-adenosyl-L-methionine repressor metEp 4012877 4012892 1.5 aaccgccaatTATGGATGTGTAAACATctggacggct nd [BPP] [1]
remote MetJ-S-adenosyl-L-methionine repressor metEp 4012992 4013007 116.5 ggatgaataaACTTGCCGCCTTCCCTAaattcaaaat nd [BPP] [1]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal MetR-L-homocysteine activator metEp 4012815 4012829 -62.0 tacttcgatcATGAAAGTCCTTCACTtcggcatgaa nd [APIORCISFBSCS], [BPP], [GEA] [1], [3], [4], [5]
proximal MetR-L-homocysteine activator metEp 4012836 4012850 -41.0 tcacttcggcATGAATAATTTGCGCTtgaggaatat nd [BPP], [GEA] [1], [3], [4], [5]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal OxyR activator metEp 4012834 4012850 -42.0 cttcacttcgGCATGAATAATTTGCGCTtgaggaatat nd [CEEUMA], [IHBCE], [RSE] [6]
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA FnrS metE repressor 4013035 4013065 UAAUUAGAGGAAGAAAAAAUGACAAUAUUGA nd [IEP] [2]
