RegulonDB RegulonDB 10.10: Operon Form
   

dinQ operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: dinQ
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: dinQ
Gene(s): dinQ   Genome Browser M3D Gene expression COLOMBOS
Evidence: [BTEI] Boundaries of transcription experimentally identified
[LTED] Length of transcript experimentally determined
Reference(s): [1] Christmann M., et al., 2013
[2] Fernandez De Henestrosa AR., et al., 2000
[3] Weel-Sneve R., et al., 2013
Promoter
Name: dinQp
+1: 3647982
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 194
Sequence: actgaaactattgcaaggacgtgctggttttataacctgcatgtactgtatgattatccaGttagctctgaggcattttca
                          -35                     -10       +1                   
Note(s): Five dinQ transcripts were identified by primer extension assay Lima BP, Thanh Huyen TT, Bäsell K, Becher D, Antelmann H, Wolfe AJ,2012
Evidence: [IHBCE]
[RS-EPT-CBR]
[TIM]
Reference(s): [4] Salgado H, et al., 2012
[3] Weel-Sneve R., et al., 2013
Terminator(s)
Type: rho-independent
Sequence: aatgcgttaaATGTTAAAGGGCTAAGAGTAGTGTGCTCTTAGCCCTTAattacgtttc
Reference(s): [3] Weel-Sneve R., et al., 2013
TF binding sites (TFBSs)
[LexA,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal LexA repressor dinQp 3647980 3647999 -7.5 aacctgcatgTACTGTATGATTATCCAGTTagctctgagg nd [GEA], [AIBSCS], [APIORCISFBSCS] [2], [3]
proximal LexA repressor dinQp 3648002 3648021 -29.5 tgcaaggacgTGCTGGTTTTATAACCTGCAtgtactgtat nd [APIORCISFBSCS] [3]
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA AgrB dinQ repressor 3647864 3647895 UUAGAUAAGAACUCUCUCACUCCGGCCAGAGC nd [IHBCE], [NABE] [5]


Evidence    

 [IHBCE] Inferred by a human based on computational evidence

 [RS-EPT-CBR] RNA-seq using two enrichment strategies for primary transcripts and consistent biological replicates

 [TIM] Transcription initiation mapping

 [GEA] Gene expression analysis

 [AIBSCS] Automated inference based on similarity to consensus sequences

 [APIORCISFBSCS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [NABE] Nucleic acid binding evidence


Reference(s)    

 [1] Christmann M., Schmaler T., Gordon C., Huang X., Bayram O., Schinke J., Stumpf S., Dubiel W., Braus GH., 2013, Control of multicellular development by the physically interacting deneddylases DEN1/DenA and COP9 signalosome., PLoS Genet 9(2):e1003275

 [2] Fernandez De Henestrosa AR., Ogi T., Aoyagi S., Chafin D., Hayes JJ., Ohmori H., Woodgate R., 2000, Identification of additional genes belonging to the LexA regulon in Escherichia coli., Mol Microbiol 35(6):1560-72

 [3] Weel-Sneve R., Kristiansen KI., Odsbu I., Dalhus B., Booth J., Rognes T., Skarstad K., Bjoras M., 2013, Single Transmembrane Peptide DinQ Modulates Membrane-Dependent Activities., PLoS Genet 9(2):e1003260

 [4] Salgado H, Peralta-Gil M, Gama-Castro S, Santos-Zavaleta A, Muñiz-Rascado L, García-Sotelo JS, Weiss V, Solano-Lira H, Martínez-Flores I, Medina-Rivera A, Salgado-Osorio G, Alquicira-Hernández S, Alquicira-Hernández K, López-Fuentes A, Porrón-Sotelo L, Huerta AM, Bonavides-Martínez C, Balderas-Martínez YI, Pannier L, Olvera M, Labastida A, Jiménez-Jacinto V, Vega-Alvarado L, Del Moral-Chávez V, Hernández-Alvarez A, Morett E, Collado-Vides J., 2012, RegulonDB v8.0: omics data sets, evolutionary conservation, regulatory phrases, cross-validated gold standards and more., Nucleic Acids Res.

 [5] Kristiansen KI., Weel-Sneve R., Booth JA., Bjoras M., 2016, Mutually exclusive RNA secondary structures regulate translation initiation of DinQ in Escherichia coli., RNA 22(11):1739-1749

RegulonDB