RegulonDB RegulonDB 11.1: Operon Form
   

fimB operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: fimB
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: fimB
Gene(s): fimB   Genome Browser M3D Gene expression COLOMBOS
Note(s): ppGpp, DksA, and GreA are non-DNA-binding regulatory molecules which control positively the transcription of fimBp2 expression through binding to RNAP. DksA and ppGpp stimulate transcription from the fimBp2 promoter both independently and codependently Aberg A,2008
Baljinder et al. showed that NanR, NagC, and IHF activate fimB gene expression, but they could not determine which of the three promoters (fimBp1, fimBp2, or fimBp3) is affected Sohanpal BK,2007. Sohanpal BK,2004 and none could demonstrate which is the transcription activation mechanism. They concluded that the activation from NagC and IHF could be indirect, altering the DNA structure of the intergenic region between fimB and nanC. Another possibility for system activation is through direct contact of NagC with RNA polymerase Sohanpal BK,2007. Sohanpal BK,2004
There are three potential transcription start sites. Transcription starting from two of these sites (P1 and P2) would produce a similar-sized mRNA to the one of fimB, previously detected by Northern blot hybridizations.
Evidence: [EXP-IDA-TRANSCRIPT-LEN-DETERMINATION] Length of transcript experimentally determined
Reference(s): [1] Schwan WR., et al., 1992
[2] Schwan WR., et al., 1994
Promoter
Name: fimBp2
+1: 4540667
Distance from start of the gene: 290
Sequence: tgaacgaatattaaattttgctgaattttttatgttgattttacttgttacagaacatatCacatgatatatagataagat
Note(s): A σ32-dependent promoter was suggested to be located upstream of fimB Wade JT,2006, but it is unknown whether this promoter is the same as fimBp2d.
Evidence: [EXP-IDA-TRANSCRIPTION-INIT-MAPPING]
Reference(s): [2] Schwan WR., et al., 1994
TF binding sites (TFBSs)
[BasR,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal BasR-phosphorylated activator fimBp2 4540616 4540635 -41.5 ttgaacgaatATTAAATTTTGCTGAATTTTttatgttgat nd [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] nd [10]
[H-NS,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd H-NS repressor fimBp2 nd nd nd nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [11], [12], [13]
[IHF,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote IHF activator fimBp2 4540085 4540097 -576.0 agatcttagtTTAACTATTTGTTttataaataa nd [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION] C [9]
[NagC,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote NagC activator fimBp2 4539982 4540004 -674.0 aaaccagattTGCAATTCGTGTCACAAAATATGtcgatctttt nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION] C [4], [8], [9]
remote NagC activator fimBp2 4540194 4540216 -462.0 tcaggctgagCATAATTCTCATCATGAAATATGtttcctggtt nd [COMP-AINF-SIMILAR-TO-CONSENSUS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION] C [8]
[NanR,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote NanR activator fimBp2 4539920 4539925 -744.5 actatcttggTGCACCtttatacctg nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-GSELEX], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION] C [4], [5], [6], [7], [8], [9]
remote NanR activator fimBp2 4539928 4539933 -736.5 ggtgcaccttTATACCtgttatacca nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-GSELEX], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION] C [4], [5], [6], [7], [8], [9]
remote NanR activator fimBp2 4539937 4539942 -727.5 ttatacctgtTATACCagatcaaaaa nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-GSELEX], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION] C [4], [5], [6], [7], [8], [9]
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA MicA fimB repressor 4540901 4540936 GGAUUAUUGCUAACCCAGCACAGCUAGUGCGCGUCU nd [EXP-IEP] [3]
Allosteric regulation of RNA-polymerase
  Regulator Function Promoter target of RNApol Growth Conditions Note Evidence Reference
  DksA activation fimBp2 nd   [EXP-IDA-PURIFIED-PROTEIN]
[EXP-IEP-GENE-EXPRESSION-ANALYSIS] 		[14]
  DksA-ppGpp activation fimBp2 nd   [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]
[EXP-IEP-GENE-EXPRESSION-ANALYSIS] 		[14]
  ppGpp activation fimBp2 nd   [EXP-IDA]
[EXP-IEP-GENE-EXPRESSION-ANALYSIS] 		[14]
Evidence: [EXP-IDA-PURIFIED-PROTEIN] Assay of protein purified to homogeneity
[EXP-IEP-GENE-EXPRESSION-ANALYSIS] Gene expression analysis
[EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] Binding of purified proteins
[EXP-IDA] Inferred from direct assay
Reference(s): [14] Aberg A., et al., 2008


Transcription unit          
Name: fimB
Gene(s): fimB   Genome Browser M3D Gene expression COLOMBOS
Evidence: [EXP-IDA-TRANSCRIPT-LEN-DETERMINATION] Length of transcript experimentally determined
Reference(s): [1] Schwan WR., et al., 1992
[2] Schwan WR., et al., 1994
Promoter
Name: fimBp1
+1: 4540809
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 148
Sequence: tacatagcatgcaagagcatggcgtttgtatggcaacgttattataattaacagttgctaCtccatttaagttcactcaga
                          -35                    -10        +1                   
Note(s): Baljinder et al. showed that NanR, NagC, and IHF activate fimBgene expression, but they could not determine which of the three promoters (fimBp1, fimBp2, fimBp3) is affected Sohanpal BK,2007. Sohanpal BK,2004 and none could demonstrate which is the transcription activation mechanism. They concluded that the activation from NagC and IHF could be indirect, altering the DNA structure of the intergenic region between fimB and nanC. Another possibility of activating the system is through direct contact of NagC with RNA polymerase Sohanpal BK,2007. Sohanpal BK,2004
There are three potential transcription start sites. Transcription starting from two of the sites (P1 and P2) would produce an mRNA that approximates the transcript size of fimB previously detected by Northern blot hybridizations.
Evidence: [COMP-AINF]
[COMP-HINF]
[EXP-IDA-TRANSCRIPTION-INIT-MAPPING]
Reference(s): [15] Huerta AM., et al., 2003
[2] Schwan WR., et al., 1994
TF binding sites (TFBSs)
[H-NS,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd H-NS repressor fimBp1 nd nd nd nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [11], [12], [13]
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA MicA fimB repressor 4540901 4540936 GGAUUAUUGCUAACCCAGCACAGCUAGUGCGCGUCU nd [EXP-IEP] [3]


Transcription unit       
Name: fimB
Gene(s): fimB   Genome Browser M3D Gene expression COLOMBOS
Evidence: [EXP-IDA-TRANSCRIPT-LEN-DETERMINATION] Length of transcript experimentally determined
Reference(s): [1] Schwan WR., et al., 1992
[2] Schwan WR., et al., 1994
Promoter
Name: fimBp3
+1: Unknown
Note(s): Baljinder et al. showed that NanR, NagC, and IHF activate fimB gene expression, but they could not determine which of the three promoters (fimBp1, fimBp2, or fimBp3) is affected Sohanpal BK,2007. Sohanpal BK,2004 and none could demonstrate which is the transcription activation mechanism. They concluded that the activation from NagC and IHF could be indirect, altering the DNA structure of the intergenic region between fimB and nanC. Another possibility of activating the system is through direct contact of NagC with RNA polymerase Sohanpal BK,2007. Sohanpal BK,2004
There are three potential transcription start sites. Transcription starting from two of the sites (P1 and P2) would produce an mRNA that approximates the transcript size of fimB previously detected by Northern blot hybridizations.
On the other hand, a σ32-dependent promoter was suggested to be located upstream of fimB Wade JT,2006 but it is unknown whether this promoter is the same as fimBp2 .
Evidence: [EXP-IDA-TRANSCRIPTION-INIT-MAPPING]
Reference(s): [2] Schwan WR., et al., 1994


Evidence    

 [EXP-IDA-TRANSCRIPTION-INIT-MAPPING] Transcription initiation mapping

 [COMP-HINF-SIMILAR-TO-CONSENSUS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] Binding of purified proteins

 [EXP-IEP-GENE-EXPRESSION-ANALYSIS] Gene expression analysis

 [EXP-IMP-SITE-MUTATION] Site mutation

 [COMP-AINF-SIMILAR-TO-CONSENSUS] Automated inference based on similarity to consensus sequences

 [EXP-GSELEX] high throughput Genomic SELEX-chip evidence

 [EXP-IEP] Inferred from expression pattern

 [COMP-AINF] Inferred computationally without human oversight

 [COMP-HINF] Inferred by a human based on computational evidence


Reference(s)    

 [1] Schwan WR., Seifert HS., Duncan JL., 1992, Growth conditions mediate differential transcription of fim genes involved in phase variation of type 1 pili., J Bacteriol 174(7):2367-75

 [2] Schwan WR., Seifert HS., Duncan JL., 1994, Analysis of the fimB promoter region involved in type 1 pilus phase variation in Escherichia coli., Mol Gen Genet 242(5):623-30

 [3] Gogol EB., Rhodius VA., Papenfort K., Vogel J., Gross CA., 2011, Small RNAs endow a transcriptional activator with essential repressor functions for single-tier control of a global stress regulon., Proc Natl Acad Sci U S A 108(31):12875-80

 [4] Condemine G., Berrier C., Plumbridge J., Ghazi A., 2005, Function and expression of an N-acetylneuraminic acid-inducible outer membrane channel in Escherichia coli., J Bacteriol 187(6):1959-65

 [5] El-Labany S., Sohanpal BK., Lahooti M., Akerman R., Blomfield IC., 2003, Distant cis-active sequences and sialic acid control the expression of fimB in Escherichia coli K-12., Mol Microbiol 49(4):1109-18

 [6] Kalivoda KA., Steenbergen SM., Vimr ER., 2013, Control of the Escherichia coli sialoregulon by transcriptional repressor NanR., J Bacteriol 195(20):4689-701

 [7] Shimada T., Ogasawara H., Ishihama A., 2018, Single-target regulators form a minor group of transcription factors in Escherichia coli K-12., Nucleic Acids Res 46(8):3921-3936

 [8] Sohanpal BK., El-Labany S., Lahooti M., Plumbridge JA., Blomfield IC., 2004, Integrated regulatory responses of fimB to N-acetylneuraminic (sialic) acid and GlcNAc in Escherichia coli K-12., Proc Natl Acad Sci U S A 101(46):16322-7

 [9] Sohanpal BK., Friar S., Roobol J., Plumbridge JA., Blomfield IC., 2007, Multiple co-regulatory elements and IHF are necessary for the control of fimB expression in response to sialic acid and N-acetylglucosamine in Escherichia coli K-12., Mol Microbiol 63(4):1223-36

 [10] Ogasawara H., Shinohara S., Yamamoto K., Ishihama A., 2012, Novel regulation targets of the metal-response BasS-BasR two-component system of Escherichia coli., Microbiology 158(Pt 6):1482-92

 [11] Donato GM., Kawula TH., 1999, Phenotypic analysis of random hns mutations differentiate DNA-binding activity from properties of fimA promoter inversion modulation and bacterial motility., J Bacteriol 181(3):941-8

 [12] Donato GM., Lelivelt MJ., Kawula TH., 1997, Promoter-specific repression of fimB expression by the Escherichia coli nucleoid-associated protein H-NS., J Bacteriol 179(21):6618-25

 [13] Olsen PB., Schembri MA., Gally DL., Klemm P., 1998, Differential temperature modulation by H-NS of the fimB and fimE recombinase genes which control the orientation of the type 1 fimbrial phase switch., FEMS Microbiol Lett 162(1):17-23

 [14] Aberg A., Shingler V., Balsalobre C., 2008, Regulation of the fimB promoter: a case of differential regulation by ppGpp and DksA in vivo., Mol Microbiol 67(6):1223-41

 [15] Huerta AM., Collado-Vides J., 2003, Sigma70 promoters in Escherichia coli: specific transcription in dense regions of overlapping promoter-like signals., J Mol Biol 333(2):261-78

 [16] Mihailovic MK., Ekdahl AM., Chen A., Leistra AN., Li B., Gonzalez Martinez J., Law M., Ejindu C., Masse E., Freddolino PL., Contreras LM., 2021, Uncovering Transcriptional Regulators and Targets of sRNAs Using an Integrative Data-Mining Approach: H-NS-Regulated RseX as a Case Study., Front Cell Infect Microbiol 11:696533

RegulonDB