RegulonDB RegulonDB 10.10: Operon Form
   

cycA operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: cycA
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit       
Name: cycA
Gene(s): cycA   Genome Browser M3D Gene expression COLOMBOS
Evidence: [ICWHO] Inferred computationally without human oversight
Promoter
Name: cycAp
+1: 4429780
Distance from start of the gene: 84
Sequence: aattaacattagatctaaatcttagtattcatcccgcgtattgttacctaatatcgatgaGtcccgatacagattcgtcgt
Evidence: [HTTIM]    
[RS-EPT-CBR]
Reference(s): [1] Mendoza-Vargas A., et al., 2009
[2] Salgado H, et al., 2012
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA GcvB cycA repressor 4429838 4429870 ACAGACAGGUACAGGAAGAAAAAAACAUGGUAG nd [GEA] [3]





RegulonDB