RegulonDB RegulonDB 10.9: Operon Form
   

folX-yfcH operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: folX-yfcH
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit       
Name: folX-yfcH
Gene(s): folX, yfcH   Genome Browser M3D Gene expression COLOMBOS
Evidence: [BTEI] Boundaries of transcription experimentally identified
[ICWHO] Inferred computationally without human oversight
Reference(s): [1] Zaslaver A., et al., 2006
Promoter
Name: folXp
+1: Unknown
Note(s): Zaslaver et al. demonstrated in 2006, by means of a library of fluorescent transcription fusions, that this promoter can be transcribed in vitro Zaslaver A,2006. Based on this, a putative promoter was suggested, but the +1 site of the transcription initiation has not been determined, although there exists promoter activity.
Evidence: [IEP]
Reference(s): [1] Zaslaver A., et al., 2006
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA FnrS folX-yfcH repressor 2421301 2421323 AAGUAAAACAACGGAGAACCUGC nd [IEP] [2]





RegulonDB