RegulonDB RegulonDB 10.10: Operon Form

yobA-yebZY operon and associated TUs in Escherichia coli K-12 genome

Name: yobA-yebZY
This page displays every known transcription unit of this operon and their known regulation.

Transcription unit       
Name: yobA-yebZY
Gene(s): yebY, yebZ, yobA   Genome Browser M3D Gene expression COLOMBOS
Evidence: [ICWHO] Inferred computationally without human oversight
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA FnrS yobA-yebZY repressor 1924952 1924986 GCGUGCAGUUGAAGCCAUAUUAUCUAUUCCUUUUU nd [IEP] [1]
