RegulonDB RegulonDB 11.1: Operon Form
   

yobA-yebZY operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: yobA-yebZY
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit       
Name: yobA-yebZY
Gene(s): yebY, yebZ, yobA   Genome Browser M3D Gene expression COLOMBOS
Evidence: [COMP-AINF] Inferred computationally without human oversight
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA FnrS yobA-yebZY repressor 1924952 1924986 GCGUGCAGUUGAAGCCAUAUUAUCUAUUCCUUUUU nd [EXP-IEP] [1]


Evidence    

 [EXP-IEP] Inferred from expression pattern


Reference(s)    

 [1] Boysen A., Moller-Jensen J., Kallipolitis B., Valentin-Hansen P., Overgaard M., 2010, Translational regulation of gene expression by an anaerobically induced small non-coding RNA in Escherichia coli., J Biol Chem 285(14):10690-702

RegulonDB