RegulonDB RegulonDB 10.9: Operon Form
   

shiA operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: shiA
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit       
Name: shiA
Gene(s): shiA   Genome Browser M3D Gene expression COLOMBOS
Evidence: [ICWHO] Inferred computationally without human oversight
Promoter
Name: shiAp
+1: 2053566
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 77
Sequence: ttgccgctaatcagccataaaatcatttgcagatgcgctctgtcgaggtagtctcataagGttcgtttatagatcgacggc
                           -35                   -10        +1                   
Evidence: [HTTIM]
[RS-EPT-CBR]
[TIM]
Reference(s): [1] Liu F., et al., 2018
[2] Prevost K., et al., 2007
[3] Salgado H, et al., 2012
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA RyhB shiA activator 2053566 2053616 GUUCGUUUAUAGAUCGACGGCAAUGUGAGUUACCUUUUCCAUACUAAUUAU TRANSLATION-BLOCKING, MRNA-DEGRADATION [IEP], [SM] [2]





RegulonDB