RegulonDB RegulonDB 10.9: Operon Form
   

hemB operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: hemB
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit       
Name: hemB
Gene(s): hemB   Genome Browser M3D Gene expression COLOMBOS
Note(s): A potential RNA G-quadruplex structure, formed by guanine-rich sequences located in the coding sequence region of the gene, was identified for hemB . This structure could regulate the expression of the gene, as observed for hemL gene expression 31964733.
Evidence: [BTEI] Boundaries of transcription experimentally identified
[ICWHO] Inferred computationally without human oversight
Reference(s): [1] Echelard Y., et al., 1988
Promoter
Name: hemBp
+1: 389754
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 27
Sequence: tgtcaacatcgcgacaactttcgtaaaacatccctaccctgcttcaggtatactatgcccCtcgattccacaaacatcagg
                       -35                       -10        +1                   
Note(s): The -10 box of hemB (TATACT) shows a typical Pribnow box, differing only by 1 nucleotide (TATAAT). On the other hand, the -35 sequence, GTAAAA, is atypical, compared with the consensus sequence, TTGACA, for this box Echelard Y,1988. The authors suggested that mutation/deletion studies will allow better definition of its position Echelard Y,1988.
Evidence: [IHBCE]
[RS-EPT-CBR]
[TIM]
Reference(s): [1] Echelard Y., et al., 1988
[2] Salgado H, et al., 2012
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA RyhB hemB repressor 388829 388854 GAACCUAAGCUUUCGAGCACGACUUU nd [ICA], [IEP] [3]





RegulonDB