RegulonDB RegulonDB 10.9: Operon Form
   

hemH operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: hemH
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: hemH
Gene(s): hemH   Genome Browser M3D Gene expression COLOMBOS
Note(s): The transcription of the hemH gene is repressed during the first 24 h after the induction of nitrogen starvation 32571968.
Evidence: [ICWHO] Inferred computationally without human oversight
Reference(s): [1] Zheng M., et al., 2001
Promoter
Name: hemHp
+1: 498031
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 24
Sequence: tgatttgacctctcacagcaattagttcttcttcctcacttttccgctacaattatcaacAagttgaatcgataagaggcg
                      -35                       -10         +1                   
Evidence: [ICWHO]
[TIM]
Reference(s): [2] Huerta AM., et al., 2003
[1] Zheng M., et al., 2001
TF binding sites (TFBSs)
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal OxyR activator hemHp 497968 497984 -55.0 ctattcctttTTCTGATTTGACCTCTCAcagcaattag [BPP], [GEA] [1]
proximal OxyR activator hemHp 497990 498006 -33.0 ctctcacagcAATTAGTTCTTCTTCCTCacttttccgc [BPP], [GEA] [1]
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA RyhB hemH repressor 498841 498876 CAGGUGAUGUGCCCGGGCUUUGCUGCGGAUUGUCUG nd [ICA], [IEP] [3]





RegulonDB