RegulonDB RegulonDB 11.1: Operon Form

maeA operon and associated TUs in Escherichia coli K-12 genome

Name: maeA
This page displays every known transcription unit of this operon and their known regulation.

Transcription unit       
Name: maeA
Gene(s): maeA   Genome Browser M3D Gene expression COLOMBOS
Evidence: [COMP-AINF] Inferred computationally without human oversight
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA FnrS maeA repressor 1555660 1555690 UUGGUUCCAUGUCACUCACUCUUUUUUGAAU nd [EXP-IEP], [EXP-IMP-SITE-MUTATION] [1]
