RegulonDB RegulonDB 11.0: Operon Form
   

maeA operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: maeA
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit       
Name: maeA
Gene(s): maeA   Genome Browser M3D Gene expression COLOMBOS
Evidence: [ICWHO] Inferred computationally without human oversight
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA FnrS maeA repressor 1555660 1555690 UUGGUUCCAUGUCACUCACUCUUUUUUGAAU nd [IEP], [SM] [1]


Evidence    

 [IEP] Inferred from expression pattern

 [SM] Site mutation


Reference(s)    

 [1] Durand S., Storz G., 2010, Reprogramming of anaerobic metabolism by the FnrS small RNA., Mol Microbiol 75(5):1215-31

 [2] Beisel CL., Storz G., 2011, The base-pairing RNA spot 42 participates in a multioutput feedforward loop to help enact catabolite repression in Escherichia coli., Mol Cell 41(3):286-97

RegulonDB