RegulonDB RegulonDB 10.9: Operon Form
   

symE operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: symE
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: symE
Synonym(s): yjiW
Gene(s): symE   Genome Browser M3D Gene expression COLOMBOS
Evidence: [LTED] Length of transcript experimentally determined
Reference(s): [1] Fernandez De Henestrosa AR., et al., 2000
Promoter
Name: symEp
+1: 4579917
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 77
Sequence: ttgcccattttattctatttttagctggactttccccatatttactgatgatatatacagGtatttagcgcggtgcggatg
                                -35                   -10   +1                   
Evidence: [HIPP]
[ICWHO]
[TAS]
Reference(s): [2] Huerta AM., et al., 2003
[3] Kawano M., et al., 2007
TF binding sites (TFBSs)
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal LexA repressor symEp 4579916 4579935 -8.5 ttccccatatTTACTGATGATATATACAGGTatttagcgcg nd [AIBSCS], [BPP] [1]
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA antitoxin SymR symE repressor 4579835 4579911 AGUCAUAACUGCUAUUCUCCAGGAAUAGUGAUUGUGAUUAGCGAUGCGGGUGUGUUGGCGCACAUCCGCACCGCGCU MRNA-DEGRADATION [IMP] [3]





RegulonDB