![]() ![]() ![]() |
Name: | gadW | ||||||||||||
Gene(s): | gadW Genome Browser M3D Gene expression COLOMBOS | ||||||||||||
Note(s): | Genes involved in the gad (gadABCDEWX) system are common under many adverse conditions, as determined by microarray analyses and Fourier transform-infrared spectroscopy. Although they are known to be important for the acid stress response, it has also been shown that part of this system is also upregulated by NaCl, cold stress, ethanol, and heat stress Moen B,2009 The sequence of the putative stem-loop structure located 334 nt downstream of the gadW stop codon reportedly may function as a rho-independent terminator Tramonti A,2008 however, the putative terminator sequence was not shown in the paper. The expression of the gene gadW is increased under acidic growth conditions in either aerobiosis or microaerobiosis Marzan LW,2013 |
||||||||||||
Evidence: | [LTED] Length of transcript experimentally determined | ||||||||||||
Reference(s): | [1] Tramonti A., et al., 2008 | ||||||||||||
Promoter | |||||||||||||
Name: | gadWp1 | ||||||||||||
+1: | 3664651 | ||||||||||||
Distance from start of the gene: | 33 | ||||||||||||
Sequence: |
Evidence: |
[TIM]
|
Reference(s): |
[1] Tramonti A., et al., 2008
|
Terminator(s) |
| Type: |
rho-independent |
Sequence: |
gtaaatgagaGTAAGGTTGAACATGAAGGTTCAGCCTTACTctttcctgct |
Reference(s): |
[1] Tramonti A., et al., 2008
|
|
Name: | gadW | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene(s): | gadW Genome Browser M3D Gene expression COLOMBOS | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Note(s): | Genes involved in the gad (gadABCDEWX) system are common under many adverse conditions, as determined by microarray analyses and Fourier transform-infrared spectroscopy. Although they are known to be important for the acid stress response, it has also been shown that part of this system is also upregulated by NaCl, cold stress, ethanol, and heat stress Moen B,2009 The expression of the gadW gene was induced by SidA in the presence of N-(3-oxo-hexanoyl)-L-homoserine lactone (AHL) at 30 C, although the expression was negatively responsive in the presence of ethyl acetate (EA) at 37 C Dyszel JL,2010 It is not known if the regulation of the gadW gene by SdiA is dependent on the gadWp1 or gadWp2 promoter or both. The transcription of gadW appears to be increased under acidic growth conditions during the exponential phase in a RcsB-dependent manner, but not during stationary phase Johnson MD,2011. Marzan LW,2013 However, it is not known which of the three promoters that transcribe this gene is affected by RcsB. The sequence of the putative stem-loop structure located 334 nt downstream of the gadW stop codon reportedly may function as a rho-independent terminator Tramonti A,2008 however, the putative terminator sequence was not shown in the paper. |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Evidence: | [LTED] Length of transcript experimentally determined | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Reference(s): | [1] Tramonti A., et al., 2008 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Promoter | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Name: | gadWp2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+1: | 3664781 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Distance from start of the gene: | 163 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence: |
Evidence: |
[TIM]
|
Reference(s): |
[1] Tramonti A., et al., 2008
|
Terminator(s) |
| Type: |
rho-independent |
Sequence: |
gtaaatgagaGTAAGGTTGAACATGAAGGTTCAGCCTTACTctttcctgct |
Reference(s): |
[1] Tramonti A., et al., 2008
|
|
Name: | gadX |
Gene(s): | gadX Genome Browser M3D Gene expression COLOMBOS |
Note(s): | gadX gene expression is induced under exposure to hydrogen peroxide Hodges AP,2010 UspE regulates positively the transcription of the gadX gene in an unknown way, and GadX induces the transcription of uspE Hodges AP,2010 The expression of the gene gadX is increased by PhoB under acidic growth conditions Marzan LW,2013 The mRNA produced by the gadX gene has been observed mainly in the poles of the cell Kannaiah S, Livny J, Amster-Choder O,2019. |
Evidence: | [LTED] Length of transcript experimentally determined |
Reference(s): | [8] Tramonti A., et al., 2002 |
Promoter | |
Name: | gadXp |
+1: | 3665839 |
Sigma Factor: | Sigma38 Sigmulon |
Distance from start of the gene: | 29 |
Sequence: |
tttaaatttatttatcaatcaatttgacttaagagggcggcgtgctacattaataaacagTaatatgtttatgtaatatta -35 -10 +1 |
Evidence: |
[APIORCISFBSCS] [HIPP] [ICWHO] [TIM] |
Reference(s): |
[9] Huerta AM., et al., 2003 [8] Tramonti A., et al., 2002 |
Terminator(s) | |
Type: | rho-independent |
Sequence: | aacggtttatTAGTCTGGAGACGGCAGACTAtcctcttccc |
Reference(s): | [8] Tramonti A., et al., 2002 |
Name: | gadXW | |||||||
Gene(s): | gadW, gadX Genome Browser M3D Gene expression COLOMBOS | |||||||
Evidence: | [ITCR] Inferred through co-regulation [LTED] Length of transcript experimentally determined |
|||||||
Reference(s): |
[1] Tramonti A., et al., 2008 [17] Tucker DL., et al., 2003 |
|||||||
Promoter | ||||||||
Name: | gadXp | |||||||
+1: | 3665839 | |||||||
Sigma Factor: | Sigma38 Sigmulon | |||||||
Distance from start of the gene: | 29 | |||||||
Sequence: |
tttaaatttatttatcaatcaatttgacttaagagggcggcgtgctacattaataaacagTaatatgtttatgtaatatta -35 -10 +1 |
|||||||
Evidence: |
[APIORCISFBSCS] [HIPP] [ICWHO] [TIM] |
|||||||
Reference(s): |
[9] Huerta AM., et al., 2003 [8] Tramonti A., et al., 2002 |
|||||||
Terminator(s) | ||||||||
Type: | rho-independent | |||||||
Sequence: | gtaaatgagaGTAAGGTTGAACATGAAGGTTCAGCCTTACTctttcctgct | |||||||
Reference(s): | [1] Tramonti A., et al., 2008 |
sRNA | TU Regulated | Function | Binding Sites | Regulatory Mechanism | Evidence (Confirmed, Strong, Weak) | Reference(s) | ||
---|---|---|---|---|---|---|---|---|
PosLeft | PosRight | Target sequence (mRNA) | ||||||
small regulatory RNA GadY | gadXW | activator | 3664864 | 3664968 | ACUGAGAGCACAAAGUUUCCCGUGCCAACAGGGAGUGUUAUAACGGUUUAUUAGUCUGGAGACGGCAGACUAUCCUCUUCCCGGUCCCCUAUGCCGGGUUUUUUU | MRNA-DEGRADATION | [IMP] | [18], [19] |
Name: | gadAX | |||||||||
Gene(s): | gadX, gadA Genome Browser M3D Gene expression COLOMBOS | |||||||||
Note(s): | Genes involved in the gad (gadABCDEWX) system are common under many adverse conditions, as determined by microarray analyses and Fourier transform-infrared spectroscopy. Although they are known to be important for the acid stress response, it has also been shown that part of this system is also upregulated by NaCl, cold stress, ethanol, and heat stress Moen B,2009 Basal GadE activity is required for activation of gadA and gadBC expression during stationary-phase growth Castanie-Cornet MP,2007 The transcription of gadAX appears to be increased under acidic growth conditions during stationary and exponential phases in a RcsB-dependent manner Johnson MD,2011. Marzan LW,2013 RcsB activity through both the RcsCD phosphorelay pathway and the RcsA pathway lowers the acid resistance Castanie-Cornet MP,2007 The role of this negative regulation might be to prevent costly runaway expression of the gad genes or to shut off the response, once the acid stress is over Castanie-Cornet MP,2007 Indole enhances the expression of several genes related to acid resistance, such as gadA, gadB, gadC, hdeA, hdeB, hdeD, slp, and gadE Hirakawa H, Hayashi-Nishino M, Yamaguchi A, Nishino K,2010 The acid resistance phenotype induced by indoles is mainly due to increased expression of the glutamine decarboxylase system Hirakawa H, Hayashi-Nishino M, Yamaguchi A, Nishino K,2010 The gadAp promoter is strongly induced by GreA overproduction only when DksA is absent, as are many other genes Vinella D, Potrykus K, Murphy H, Cashel M,2012. gadA is induced during biofilm formation Giangrossi M,2005. Schembri MA, Kjaergaard K, Klemm P,2003 |
|||||||||
Evidence: | [BTEI] Boundaries of transcription experimentally identified [LTED] Length of transcript experimentally determined |
|||||||||
Reference(s): |
[10] Shimada T., et al., 2007 [8] Tramonti A., et al., 2002 [20] Waterman SR., et al., 2003 |
|||||||||
Promoter | ||||||||||
Name: | gadAp2 | |||||||||
+1: | 3667607 | |||||||||
Sigma Factor: | Sigma38 Sigmulon | |||||||||
Distance from start of the gene: | 27 | |||||||||
Sequence: |
tatttaaattaagcctgtaatgccttgcttccattgcggataaatcctacttttttattgCcttcaaataaatttaaggag -35 -10 +1 |
|||||||||
Note(s): | σ38 factor is required for stationary phase induction but not acid induction of the gadA promoter Castanie-Cornet MP,2001. Waterman SR,2003 were able to detect transcripts of gadA in an hns rpoS double mutant, suggesting that the gadAp promoter can also be recognized by σ70. | |||||||||
Evidence: |
[HIPP] [IEP] [IHBCE] [TIM] |
|||||||||
Reference(s): |
[21] Castanie-Cornet MP., et al., 2001 [22] Dudin O., et al., 2013 [23] Itou J., et al., 2009 [20] Waterman SR., et al., 2003 |
|||||||||
Terminator(s) | ||||||||||
Type: | rho-independent | |||||||||
Sequence: | aacggtttatTAGTCTGGAGACGGCAGACTAtcctcttccc | |||||||||
Reference(s): | [8] Tramonti A., et al., 2002 |
Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence (Confirmed, Strong, Weak) | Reference(s) | |||
---|---|---|---|---|---|---|---|---|---|---|
LeftPos | RightPos | Central Rel-Pos | Sequence | |||||||
proximal | CRP-cyclic-AMP | repressor | gadAp2 | 3667659 | 3667680 | -62.5 | cgtttttctgCTTAGGATTTTGTTATTTAAATtaagcctgta | nd | [GEA], [APIORCISFBSCS] | [21] |
Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence (Confirmed, Strong, Weak) | Reference(s) | |||
---|---|---|---|---|---|---|---|---|---|---|
LeftPos | RightPos | Central Rel-Pos | Sequence | |||||||
proximal | Fis | repressor | gadAp2 | 3667616 | 3667635 | -18.0 | ccttgcttccATTGCGGATAAATCCTACTTttttattgcc | nd | [GEA], [AIBSCS] | [24] |
remote | Fis | repressor | gadAp2 | 3667692 | 3667711 | -94.0 | tatcatgttaAATGTTTATATTATAAAAAGtcgtttttct | nd | [GEA], [AIBSCS] | [24] |
remote | Fis | repressor | gadAp2 | 3667716 | 3667735 | -118.0 | gataataaagTCTGTTTTTAATATTATCATgttaaatgtt | nd | [GEA], [AIBSCS] | [24] |
remote | Fis | repressor | gadAp2 | 3667745 | 3667764 | -147.0 | aacagcaatgTTTGGGCGATTTTTATTACGataataaagt | nd | [GEA], [AIBSCS] | [24] |
Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence (Confirmed, Strong, Weak) | Reference(s) | |||
---|---|---|---|---|---|---|---|---|---|---|
LeftPos | RightPos | Central Rel-Pos | Sequence | |||||||
proximal | GadE-RcsB | activator | gadAp2 | 3667660 | 3667680 | -62.5 | cgtttttctgCTTAGGATTTTGTTATTTAAAttaagcctgt | nd | [GEA], [RSE], [APIORCISFBSCS], [BPP], [CEEUMA], [IHBCE], [SM] | [3], [12], [21], [23], [26], [27], [28], [29], [30] |
Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence (Confirmed, Strong, Weak) | Reference(s) | |||
---|---|---|---|---|---|---|---|---|---|---|
LeftPos | RightPos | Central Rel-Pos | Sequence | |||||||
proximal | GadW | activator | gadAp2 | 3667655 | 3667674 | -57.5 | tctgcttaggATTTTGTTATTTAAATTAAGcctgtaatgc | nd | [GEA], [BPP] | [13], [17] |
proximal | GadW | activator | gadAp2 | 3667676 | 3667695 | -78.0 | tatattataaAAAGTCGTTTTTCTGCTTAGgattttgtta | nd | [GEA], [BPP] | [13], [17] |
remote | GadW | activator | gadAp2 | 3667698 | 3667717 | -100.5 | taatattatcATGTTAAATGTTTATATTATaaaaagtcgt | nd | [GEA], [APIORCISFBSCS], [BPP] | [13], [17], [26] |
remote | GadW | activator | gadAp2 | 3667719 | 3667738 | -121.5 | tacgataataAAGTCTGTTTTTAATATTATcatgttaaat | nd | [GEA], [APIORCISFBSCS], [BPP] | [13], [17], [26] |
Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence (Confirmed, Strong, Weak) | Reference(s) | |||
---|---|---|---|---|---|---|---|---|---|---|
LeftPos | RightPos | Central Rel-Pos | Sequence | |||||||
proximal | GadW | repressor | gadAp2 | 3667655 | 3667674 | -57.5 | tctgcttaggATTTTGTTATTTAAATTAAGcctgtaatgc | nd | [GEA], [BPP] | [13], [17] |
proximal | GadW | repressor | gadAp2 | 3667676 | 3667695 | -78.0 | tatattataaAAAGTCGTTTTTCTGCTTAGgattttgtta | nd | [GEA], [BPP] | [13], [17] |
remote | GadW | repressor | gadAp2 | 3667698 | 3667717 | -100.5 | taatattatcATGTTAAATGTTTATATTATaaaaagtcgt | nd | [GEA], [APIORCISFBSCS], [BPP] | [13], [17], [26] |
remote | GadW | repressor | gadAp2 | 3667719 | 3667738 | -121.5 | tacgataataAAGTCTGTTTTTAATATTATcatgttaaat | nd | [GEA], [APIORCISFBSCS], [BPP] | [13], [17], [26] |
Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence (Confirmed, Strong, Weak) | Reference(s) | |||
---|---|---|---|---|---|---|---|---|---|---|
LeftPos | RightPos | Central Rel-Pos | Sequence | |||||||
proximal | GadX | activator | gadAp2 | 3667608 | 3667627 | -10.5 | ccattgcggaTAAATCCTACTTTTTTATTGccttcaaata | nd | [GEA], [BPP] | [8], [13], [15], [17], [26] |
proximal | GadX | activator | gadAp2 | 3667629 | 3667648 | -31.5 | taagcctgtaATGCCTTGCTTCCATTGCGGataaatccta | nd | [GEA], [BPP] | [8], [13], [15], [17], [26] |
proximal | GadX | activator | gadAp2 | 3667655 | 3667674 | -57.5 | tctgcttaggATTTTGTTATTTAAATTAAGcctgtaatgc | nd | [GEA], [BPP] | [8], [13], [15], [17], [26] |
proximal | GadX | activator | gadAp2 | 3667676 | 3667695 | -78.0 | tatattataaAAAGTCGTTTTTCTGCTTAGgattttgtta | nd | [GEA], [BPP] | [8], [13], [15], [17], [26] |
remote | GadX | activator | gadAp2 | 3667698 | 3667717 | -100.5 | taatattatcATGTTAAATGTTTATATTATaaaaagtcgt | nd | [GEA], [APIORCISFBSCS], [BPP] | [8], [13], [15], [17], [26] |
remote | GadX | activator | gadAp2 | 3667719 | 3667738 | -121.5 | tacgataataAAGTCTGTTTTTAATATTATcatgttaaat | nd | [GEA], [APIORCISFBSCS], [BPP] | [8], [13], [15], [17], [26] |
Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence (Confirmed, Strong, Weak) | Reference(s) | |||
---|---|---|---|---|---|---|---|---|---|---|
LeftPos | RightPos | Central Rel-Pos | Sequence | |||||||
proximal | RcsB-phosphorylated | repressor | gadAp2 | 3667619 | 3667632 | -18.5 | tgcttccattGCGGATAAATCCTActtttttatt | nd | [GEA], [BPP], [IHBCE], [SM] | [27], [28], [31] |
Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence (Confirmed, Strong, Weak) | Reference(s) | |||
---|---|---|---|---|---|---|---|---|---|---|
LeftPos | RightPos | Central Rel-Pos | Sequence | |||||||
remote | TorR-phosphorylated | repressor | gadAp2 | 3667530 | 3667539 | 73.5 | cagaactactCGATTCACGTtttggcgcaa | nd | [GEA], [AIBSCS] | [25] |
remote | TorR-phosphorylated | repressor | gadAp2 | 3667725 | 3667734 | -122.5 | ataataaagtCTGTTTTTAAtattatcatg | nd | [GEA], [AIBSCS] | [25] |
Evidence: | [EME] Expression microarray evidence |
Reference(s): | [33] Traxler MF., et al., 2008 |
Name: | gadAX | |||||||||
Gene(s): | gadX, gadA Genome Browser M3D Gene expression COLOMBOS | |||||||||
Note(s): | Genes involved in the gad (gadABCDEWX) system are common under many adverse conditions, as determined by microarray analyses and Fourier transform-infrared spectroscopy. Although they are known to be important for the acid stress response, it has also been shown that part of this system is also upregulated by NaCl, cold stress, ethanol, and heat stress Moen B,2009 Basal GadE activity is required for activation of gadA and gadBC expression during stationary-phase growth Castanie-Cornet MP,2007 The transcription of gadAX appears to be increased under acidic growth conditions during stationary and exponential phases in a RcsB-dependent manner Johnson MD,2011. Marzan LW,2013 RcsB activity through both the RcsCD phosphorelay pathway and the RcsA pathway lowers the acid resistance Castanie-Cornet MP,2007 The role of this negative regulation might be to prevent costly runaway expression of the gad genes or to shut off the response, once the acid stress is over Castanie-Cornet MP,2007 Indole enhances the expression of several genes related to acid resistance, such as gadA, gadB, gadC, hdeA, hdeB, hdeD, slp, and gadE Hirakawa H, Hayashi-Nishino M, Yamaguchi A, Nishino K,2010 The acid resistance phenotype induced by indoles is mainly due to increased expression of the glutamine decarboxylase system Hirakawa H, Hayashi-Nishino M, Yamaguchi A, Nishino K,2010 The gadAp promoter is strongly induced by GreA overproduction only when DksA is absent, as are many other genes Vinella D, Potrykus K, Murphy H, Cashel M,2012. gadA is induced during biofilm formation Giangrossi M,2005. Schembri MA, Kjaergaard K, Klemm P,2003 |
|||||||||
Evidence: | [BTEI] Boundaries of transcription experimentally identified [LTED] Length of transcript experimentally determined |
|||||||||
Reference(s): |
[10] Shimada T., et al., 2007 [8] Tramonti A., et al., 2002 [20] Waterman SR., et al., 2003 |
|||||||||
Promoter | ||||||||||
Name: | gadAp | |||||||||
+1: | 3667607 | |||||||||
Sigma Factor: | Sigma70 Sigmulon | |||||||||
Distance from start of the gene: | 27 | |||||||||
Sequence: |
tatttaaattaagcctgtaatgccttgcttccattgcggataaatcctacttttttattgCcttcaaataaatttaaggag -35 -10 +1 |
|||||||||
Note(s): | σ38 factor is required for stationary phase induction but not acid induction of the gadA promoter Castanie-Cornet MP,2001. Waterman SR,2003 were able to detect transcripts of gadA in an hns rpoS double mutant, suggesting that the gadAp promoter can also be recognized by σ70. | |||||||||
Evidence: |
[HIPP] [ICWHO] [IEP] [TIM] |
|||||||||
Reference(s): |
[21] Castanie-Cornet MP., et al., 2001 [9] Huerta AM., et al., 2003 [23] Itou J., et al., 2009 [34] Maciag A., et al., 2011 [20] Waterman SR., et al., 2003 |
|||||||||
Terminator(s) | ||||||||||
Type: | rho-independent | |||||||||
Sequence: | aacggtttatTAGTCTGGAGACGGCAGACTAtcctcttccc | |||||||||
Reference(s): | [8] Tramonti A., et al., 2002 |
Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence (Confirmed, Strong, Weak) | Reference(s) | |||
---|---|---|---|---|---|---|---|---|---|---|
LeftPos | RightPos | Central Rel-Pos | Sequence | |||||||
proximal | CRP-cyclic-AMP | repressor | gadAp | 3667659 | 3667680 | -62.5 | cgtttttctgCTTAGGATTTTGTTATTTAAATtaagcctgta | nd | [GEA], [APIORCISFBSCS] | [21] |
Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence (Confirmed, Strong, Weak) | Reference(s) | |||
---|---|---|---|---|---|---|---|---|---|---|
LeftPos | RightPos | Central Rel-Pos | Sequence | |||||||
proximal | Fis | repressor | gadAp | 3667616 | 3667635 | -18.0 | ccttgcttccATTGCGGATAAATCCTACTTttttattgcc | nd | [GEA], [AIBSCS] | [24] |
remote | Fis | repressor | gadAp | 3667692 | 3667711 | -94.0 | tatcatgttaAATGTTTATATTATAAAAAGtcgtttttct | nd | [GEA], [AIBSCS] | [24] |
remote | Fis | repressor | gadAp | 3667716 | 3667735 | -118.0 | gataataaagTCTGTTTTTAATATTATCATgttaaatgtt | nd | [GEA], [AIBSCS] | [24] |
remote | Fis | repressor | gadAp | 3667745 | 3667764 | -147.0 | aacagcaatgTTTGGGCGATTTTTATTACGataataaagt | nd | [GEA], [AIBSCS] | [24] |
Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence (Confirmed, Strong, Weak) | Reference(s) | |||
---|---|---|---|---|---|---|---|---|---|---|
LeftPos | RightPos | Central Rel-Pos | Sequence | |||||||
proximal | GadE-RcsB | activator | gadAp | 3667660 | 3667680 | -62.5 | cgtttttctgCTTAGGATTTTGTTATTTAAAttaagcctgt | nd | [GEA], [RSE], [APIORCISFBSCS], [BPP], [CEEUMA], [IHBCE], [SM] | [3], [12], [21], [23], [26], [27], [28], [29], [30] |
Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence (Confirmed, Strong, Weak) | Reference(s) | |||
---|---|---|---|---|---|---|---|---|---|---|
LeftPos | RightPos | Central Rel-Pos | Sequence | |||||||
proximal | GadW | activator | gadAp | 3667655 | 3667674 | -57.5 | tctgcttaggATTTTGTTATTTAAATTAAGcctgtaatgc | nd | [GEA], [BPP] | [13], [17] |
proximal | GadW | activator | gadAp | 3667676 | 3667695 | -78.0 | tatattataaAAAGTCGTTTTTCTGCTTAGgattttgtta | nd | [GEA], [BPP] | [13], [17] |
remote | GadW | activator | gadAp | 3667698 | 3667717 | -100.5 | taatattatcATGTTAAATGTTTATATTATaaaaagtcgt | nd | [GEA], [APIORCISFBSCS], [BPP] | [13], [17], [26] |
remote | GadW | activator | gadAp | 3667719 | 3667738 | -121.5 | tacgataataAAGTCTGTTTTTAATATTATcatgttaaat | nd | [GEA], [APIORCISFBSCS], [BPP] | [13], [17], [26] |
Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence (Confirmed, Strong, Weak) | Reference(s) | |||
---|---|---|---|---|---|---|---|---|---|---|
LeftPos | RightPos | Central Rel-Pos | Sequence | |||||||
proximal | GadW | repressor | gadAp | 3667655 | 3667674 | -57.5 | tctgcttaggATTTTGTTATTTAAATTAAGcctgtaatgc | nd | [GEA], [BPP] | [13], [17] |
proximal | GadW | repressor | gadAp | 3667676 | 3667695 | -78.0 | tatattataaAAAGTCGTTTTTCTGCTTAGgattttgtta | nd | [GEA], [BPP] | [13], [17] |
remote | GadW | repressor | gadAp | 3667698 | 3667717 | -100.5 | taatattatcATGTTAAATGTTTATATTATaaaaagtcgt | nd | [GEA], [APIORCISFBSCS], [BPP] | [13], [17], [26] |
remote | GadW | repressor | gadAp | 3667719 | 3667738 | -121.5 | tacgataataAAGTCTGTTTTTAATATTATcatgttaaat | nd | [GEA], [APIORCISFBSCS], [BPP] | [13], [17], [26] |
Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence (Confirmed, Strong, Weak) | Reference(s) | |||
---|---|---|---|---|---|---|---|---|---|---|
LeftPos | RightPos | Central Rel-Pos | Sequence | |||||||
proximal | GadX | activator | gadAp | 3667608 | 3667627 | -10.5 | ccattgcggaTAAATCCTACTTTTTTATTGccttcaaata | nd | [GEA], [BPP] | [8], [13], [15], [17], [26] |
proximal | GadX | activator | gadAp | 3667629 | 3667648 | -31.5 | taagcctgtaATGCCTTGCTTCCATTGCGGataaatccta | nd | [GEA], [BPP] | [8], [13], [15], [17], [26] |
proximal | GadX | activator | gadAp | 3667655 | 3667674 | -57.5 | tctgcttaggATTTTGTTATTTAAATTAAGcctgtaatgc | nd | [GEA], [BPP] | [8], [13], [15], [17], [26] |
proximal | GadX | activator | gadAp | 3667676 | 3667695 | -78.0 | tatattataaAAAGTCGTTTTTCTGCTTAGgattttgtta | nd | [GEA], [BPP] | [8], [13], [15], [17], [26] |
remote | GadX | activator | gadAp | 3667698 | 3667717 | -100.5 | taatattatcATGTTAAATGTTTATATTATaaaaagtcgt | nd | [GEA], [APIORCISFBSCS], [BPP] | [8], [13], [15], [17], [26] |
remote | GadX | activator | gadAp | 3667719 | 3667738 | -121.5 | tacgataataAAGTCTGTTTTTAATATTATcatgttaaat | nd | [GEA], [APIORCISFBSCS], [BPP] | [8], [13], [15], [17], [26] |
Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence (Confirmed, Strong, Weak) | Reference(s) | |||
---|---|---|---|---|---|---|---|---|---|---|
LeftPos | RightPos | Central Rel-Pos | Sequence | |||||||
proximal | RcsB-phosphorylated | repressor | gadAp | 3667619 | 3667632 | -18.5 | tgcttccattGCGGATAAATCCTActtttttatt | nd | [GEA], [BPP], [IHBCE], [SM] | [27], [28], [31] |
Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence (Confirmed, Strong, Weak) | Reference(s) | |||
---|---|---|---|---|---|---|---|---|---|---|
LeftPos | RightPos | Central Rel-Pos | Sequence | |||||||
remote | TorR-phosphorylated | repressor | gadAp | 3667530 | 3667539 | 73.5 | cagaactactCGATTCACGTtttggcgcaa | nd | [GEA], [AIBSCS] | [25] |
remote | TorR-phosphorylated | repressor | gadAp | 3667725 | 3667734 | -122.5 | ataataaagtCTGTTTTTAAtattatcatg | nd | [GEA], [AIBSCS] | [25] |
RNA cis-regulatory element | ![]() |
---|
Regulation, transcriptional elongation | |
Attenuator type: | Transcriptional |
Strand: | reverse |
Structure type | Energy | LeftPos | RightPos | Sequence (RNA-strand) | |
---|---|---|---|---|---|
terminator | -21.6 | 3667748 | 3667783 | taattaatttGATCGCCCGAACAGCAATGTTTGGGCGATTTTTATtacgataata |
Notes: "The provided "Sequence" is that of the RNA strand, i.e. U's are shown instead of T's and regulators on the reverse strand will appear as the reverse complement of the sequence delimited by LeftPos-RigtPos" |
Reference(s) |
![]() |
---|---|