RegulonDB RegulonDB 10.9: Operon Form
   

feoABC operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: feoABC
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: feoABC
Gene(s): feoA, feoB, feoC   Genome Browser M3D Gene expression COLOMBOS
Note(s): The feoAB genes are upregulated by long-term (8 to 12 h) exposure of E. coli to some biocides 32385082.
A potential RNA G-quadruplex structure, formed by guanine-rich sequences located in the coding sequence region of the gene, was identified for feoB and for feoC. This structure could regulate the expression of the genes, as observed for hemL gene expression 31964733.
Evidence: [PM] Polar mutation
Reference(s): [1] Hantke K. 2003
[2] Kammler M., et al., 1993
Promoter
Name: feoAp
+1: 3540057
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 106
Sequence: accaacattcgcacacattttaagtattgctgatagaaaccattctcattatcattgtgtTgttgattatttaatctctcc
                           -35                    -10       +1                   
Evidence: [AIPP]
[ICWHO]
Reference(s): [3] Cartron ML., et al., 2006
[4] Huerta AM., et al., 2003
TF binding sites (TFBSs)
[FNR,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal FNR activator feoAp 3539956 3539978 -90.5 gctgcgatatAACCTTGAGCCACATCAACATTGagtcagatta nd [APIORCISFBSCS], [GEA] [2]
[Fur,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal Fur-Fe2+ repressor feoAp 3540033 3540047 -17.0 ttgctgatagAAACCATTCTCATTATcattgtgttg nd [APIORCISFBSCS], [GEA] [2], [5]
[NagC,?] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote NagC1 unknown feoAp 3539918 3539940 -128.0 agccagtccgGGTAATTCACTATTCGAATTATATtttcgctgcg nd [AIBSCS] nd
[OmpR,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote OmpR-phosphorylated1 activator feoAp 3539869 3539888 -178.0 ccggcaatatTTATCATTTCATTAACAACTGaaaccttaat nd [APIORCISFBSCS], [BPP], [GEA], [SM] [5]
Note(s): 1J. Oberto in 2010 identified a possible binding site for NagC, GGTAATTCACTATTCGAATTATA, in the upstream region of the feoA gene. The demonstration was based on different statistical methods Oberto J.,2010 In this case the regulator requires two binding sites to repress the transcription of the feoA gene, and for this reason the function of this binding site cannot be predicted.1OmpR is able to bind upstream of feoB, even though it is not phosphorylated, but it needs to be phosphorylated to activate the transcription CITS: [32576675]|.1OmpR is able to bind upstream of feoB, even though it is not phosphorylated, but it needs to be phosphorylated to activate the transcription CITS: [32576675]|.
2J. Oberto in 2010 identified a possible binding site for NagC, GGTAATTCACTATTCGAATTATA, in the upstream region of the feoA gene. The demonstration was based on different statistical methods Oberto J.,2010 In this case the regulator requires two binding sites to repress the transcription of the feoA gene, and for this reason the function of this binding site cannot be predicted.


Evidence    

 [AIPP] Automated inference of promoter position

 [ICWHO] Inferred computationally without human oversight

 [APIORCISFBSCS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [GEA] Gene expression analysis

 [AIBSCS] Automated inference based on similarity to consensus sequences

 [BPP] Binding of purified proteins

 [SM] Site mutation


Reference(s)    

 [1] Hantke K., 2003, Is the bacterial ferrous iron transporter FeoB a living fossil?, Trends Microbiol 11(5):192-5

 [2] Kammler M., Schon C., Hantke K., 1993, Characterization of the ferrous iron uptake system of Escherichia coli., J Bacteriol 175(19):6212-9

 [3] Cartron ML., Maddocks S., Gillingham P., Craven CJ., Andrews SC., 2006, Feo--transport of ferrous iron into bacteria., Biometals 19(2):143-57

 [4] Huerta AM., Collado-Vides J., 2003, Sigma70 promoters in Escherichia coli: specific transcription in dense regions of overlapping promoter-like signals., J Mol Biol 333(2):261-78

 [5] Gerken H., Vuong P., Soparkar K., Misra R., 2020, Roles of the EnvZ/OmpR Two-Component System and Porins in Iron Acquisition in Escherichia coli., mBio 11(3)

RegulonDB