RegulonDB RegulonDB 10.9: Operon Form

patA operon and associated TUs in Escherichia coli K-12 genome

Name: patA
This page displays every known transcription unit of this operon and their known regulation.

Transcription unit          
Name: patA
Gene(s): patA   Genome Browser M3D Gene expression COLOMBOS
Note(s): J. Oberto in 2010 identified a possible binding site for NagC, GTTAATTATCTTGCCCAAAAATC, in the intergenic region of the divergent genes aer and patA. This demonstration was based on different statistical methods Oberto J.,2010 but it is not known if NagC regulates transcription in both directions.
Transcription of the patA gene is induced under nitrogen-limited growth conditions Schneider BL,2013
and in the presence of putrescine in a growth-dependent manner Schneider BL,2013 Putrescine-dependent expression of the patA gene is controlled by at least two sigma factors: σ38 under excess nitrogen conditions and σ54 under nitrogen starvation conditions 24906570.
Evidence: [BTEI] Boundaries of transcription experimentally identified
Reference(s): [1] Samsonova NN., et al., 2003
Name: patAp
+1: 3219458
Sigma Factor: Sigma38 Sigmulon
Distance from start of the gene: 36
Sequence: gtgtttatcccgattttcgcgatcgcagccggagtggcgcaatccctgcaatacttaaatCggtatcatgtgatacgcgag
Note(s): Besides the σ54-dependent promoter that directs transcription, another σ38-dependent promoter seems to activate patA transcription. Both promoters initiate transcription at the same nucleotide. Apparently, there is competition between the two sigma factors to bind the promoter. Under nitrogen-limited conditions, σ54 appears be dominant, and σ38 dominates in nitrogen excess Schneider BL,2013
Evidence: [AIPP]
Reference(s): [1] Samsonova NN., et al., 2003
TF binding sites (TFBSs)
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote Fis1 unknown patAp 3219330 3219344 -121.0 tacccgacaaAAACCGTGCAAAATAAcaacaaatgt nd [AIBSCS] [1]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote IHF1 unknown patAp 3219196 3219208 -256.0 tttaaacacaAATCTAATTCCTTGatttaaaata nd [AIBSCS] [1]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote NtrC-phosphorylated1 activator patAp 3218907 3218924 -543.0 atccgggtgaCGCACCATGTTGTGCGGCtgcccttgta nd [AIBSCS], [IEP] [2]
remote NtrC-phosphorylated2 activator patAp 3219257 3219273 -193.0 ttaattatctTGCCCAAAAATCAGGCAAttattgccct nd [AIBSCS], [GEA] [1], [3]
remote NtrC-phosphorylated3 activator patAp 3219279 3219295 -171.0 aggcaattatTGCCCTGAAAACGTGCATttgcgcagca nd [AIBSCS], [GEA] [1], [3]
Note(s): 1The regulatory effect of Fis on the promoter ygjGp is not known Samsonova NN,2003.
1The regulatory effect of IHF on the promoter ygjGp is not known Samsonova NN,2003.1The regulatory effect of NtrC on the promoter patAp is as yet not known Samsonova NN,2003. However, we assigned a positive role to this regulatory interaction based on the facts that NtrC activates σ54 promoters and the promoter patAp is one of them.
2The regulatory effect of NtrC on the promoter patAp is as yet not known Samsonova NN,2003. However, we assigned a positive role to this regulatory interaction based on the facts that NtrC activates σ54 promoters and the promoter patAp is one of them.
3The regulatory effect of NtrC on the promoter patAp is as yet not known Samsonova NN,2003. However, we assigned a positive to this regulatory interaction based on the facts that NtrC activates sigma54 promoters and the promoter patAp is one of them.1The regulatory effect of NtrC on the promoter patAp is as yet not known Samsonova NN,2003. However, we assigned a positive role to this regulatory interaction based on the facts that NtrC activates σ54 promoters and the promoter patAp is one of them.
2The regulatory effect of IHF on the promoter ygjGp is not known Samsonova NN,2003.
3The regulatory effect of NtrC on the promoter patAp is as yet not known Samsonova NN,2003. However, we assigned a positive role to this regulatory interaction based on the facts that NtrC activates σ54 promoters and the promoter patAp is one of them.
4The regulatory effect of NtrC on the promoter patAp is as yet not known Samsonova NN,2003. However, we assigned a positive to this regulatory interaction based on the facts that NtrC activates sigma54 promoters and the promoter patAp is one of them.
5The regulatory effect of Fis on the promoter ygjGp is not known Samsonova NN,2003.

Transcription unit          
Name: patA
Gene(s): patA   Genome Browser M3D Gene expression COLOMBOS
Note(s): J. Oberto in 2010 identified a possible binding site for NagC, GTTAATTATCTTGCCCAAAAATC, in the intergenic region of the divergent genes aer and patA. This demonstration was based on different statistical methods Oberto J.,2010 but it is not known if NagC regulates transcription in both directions.
Transcription of the patA gene is induced under nitrogen-limited growth conditions Schneider BL,2013
and in the presence of putrescine in a growth-dependent manner Schneider BL,2013 Putrescine-dependent expression of the patA gene is controlled by at least two sigma factors: σ38 under excess nitrogen conditions and σ54 under nitrogen starvation conditions 24906570.
Evidence: [BTEI] Boundaries of transcription experimentally identified
Reference(s): [1] Samsonova NN., et al., 2003
Name: patAp2
+1: 3219458
Sigma Factor: Sigma54 Sigmulon
Distance from start of the gene: 36
Sequence: gtgtttatcccgattttcgcgatcgcagccggagtggcgcaatccctgcaatacttaaatCggtatcatgtgatacgcgag
                                   -24         -12          +1                   
Note(s): Besides the σ54-dependent promoter that directs transcription, another σ38-dependent promoter seems to activate patA transcription. Both promoters initiate transcription at the same nucleotide. Apparently, there is competition between the two sigma factors to bind the promoter. Under nitrogen-limited conditions, σ54 appears be dominant, and σ38 dominates in nitrogen excess Schneider BL,2013
Evidence: [AIPP]
Reference(s): [4] Huerta AM., et al., 2003
[1] Samsonova NN., et al., 2003
TF binding sites (TFBSs)
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote Fis1 unknown patAp2 3219330 3219344 -121.0 tacccgacaaAAACCGTGCAAAATAAcaacaaatgt nd [AIBSCS] [1]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote IHF1 unknown patAp2 3219196 3219208 -256.0 tttaaacacaAATCTAATTCCTTGatttaaaata nd [AIBSCS] [1]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote NtrC-phosphorylated1 activator patAp2 3218907 3218924 -543.0 atccgggtgaCGCACCATGTTGTGCGGCtgcccttgta nd [AIBSCS], [IEP] [2]
remote NtrC-phosphorylated2 activator patAp2 3219257 3219273 -193.0 ttaattatctTGCCCAAAAATCAGGCAAttattgccct nd [AIBSCS], [GEA] [1], [3]
remote NtrC-phosphorylated3 activator patAp2 3219279 3219295 -171.0 aggcaattatTGCCCTGAAAACGTGCATttgcgcagca nd [AIBSCS], [GEA] [1], [3]
Note(s): 1The regulatory effect of Fis on the promoter ygjGp is not known Samsonova NN,2003.
1The regulatory effect of IHF on the promoter ygjGp is not known Samsonova NN,2003.1The regulatory effect of NtrC on the promoter patAp is as yet not known Samsonova NN,2003. However, we assigned a positive role to this regulatory interaction based on the facts that NtrC activates σ54 promoters and the promoter patAp is one of them.
2The regulatory effect of NtrC on the promoter patAp is as yet not known Samsonova NN,2003. However, we assigned a positive role to this regulatory interaction based on the facts that NtrC activates σ54 promoters and the promoter patAp is one of them.
3The regulatory effect of NtrC on the promoter patAp is as yet not known Samsonova NN,2003. However, we assigned a positive to this regulatory interaction based on the facts that NtrC activates sigma54 promoters and the promoter patAp is one of them.1The regulatory effect of NtrC on the promoter patAp is as yet not known Samsonova NN,2003. However, we assigned a positive role to this regulatory interaction based on the facts that NtrC activates σ54 promoters and the promoter patAp is one of them.
2The regulatory effect of IHF on the promoter ygjGp is not known Samsonova NN,2003.
3The regulatory effect of NtrC on the promoter patAp is as yet not known Samsonova NN,2003. However, we assigned a positive role to this regulatory interaction based on the facts that NtrC activates σ54 promoters and the promoter patAp is one of them.
4The regulatory effect of NtrC on the promoter patAp is as yet not known Samsonova NN,2003. However, we assigned a positive to this regulatory interaction based on the facts that NtrC activates sigma54 promoters and the promoter patAp is one of them.
5The regulatory effect of Fis on the promoter ygjGp is not known Samsonova NN,2003.
