RegulonDB RegulonDB 11.0: Operon Form

ydeNM operon and associated TUs in Escherichia coli K-12 genome

Name: ydeNM
This page displays every known transcription unit of this operon and their known regulation.

Transcription unit          
Name: ydeNM
Gene(s): ydeM, ydeN   Genome Browser M3D Gene expression COLOMBOS
Note(s): The ydeNM operon is a novel AraC-regulated operon that is directly repressed by AraC in an arabinose-dependent manner Stringer AM,2014
Evidence: [IC] Inferred by curator
[ITCR] Inferred through co-regulation
Reference(s): [1] Stringer AM., et al., 2014
Name: ydeNp
+1: 1582554
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 30
Sequence: atctctttatgtgactaacttcacttacatccacttatttctcttcgtaaaattactttgGaattaagtacaataagaaga
                         -35                    -10         +1                   
Evidence: [ICWHO]
Reference(s): [2] Huerta AM., et al., 2003
[1] Stringer AM., et al., 2014
TF binding sites (TFBSs)
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd AraC-α-L-arabinopyranose repressor ydeNp nd nd nd nd nd [GEA], [BPP] [1]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal GadX repressor ydeNp 1582613 1582632 -69.0 tttttcccttTTTTTAGCTAAATCTGCTATctctttatgt nd [RSE], [CEEUMA], [IHBCE] [3]
remote GadX repressor ydeNp 1582778 1582797 -233.5 cacatatttaTGCACTTGCATAACCTGTTGcatgattatt nd [RSE], [CEEUMA], [IHBCE] [3]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal NagC repressor ydeNp 1582559 1582581 -16.0 cttacatccaCTTATTTCTCTTCGTAAAATTACtttggaatta nd [AIBSCS] nd
remote NagC repressor ydeNp 1582683 1582705 -140.0 caataaattaGTTGTTTATCGGCGAGAAATTACttaatagaac nd [AIBSCS] nd

Transcription unit       
Name: ydeM
Gene(s): ydeM   Genome Browser M3D Gene expression COLOMBOS
Evidence: [ICWHO] Inferred computationally without human oversight

Transcription unit       
Name: ydeN
Gene(s): ydeN   Genome Browser M3D Gene expression COLOMBOS
Note(s): J. Oberto in 2010 identified two possible binding sites for NagC in the upstream region of the ydeN gene (CTTATTTCTCTTCGTAAAATTAC and GTTGTTTATCGGCGAGAAATTAC). This demonstration was based on different statistical methods Oberto J.,2010
Evidence: [ICWHO] Inferred computationally without human oversight

RNA cis-regulatory element    
Regulation, transcriptional elongation  
Attenuator type: Translational
Strand: reverse
  Structure type Energy LeftPos RightPos Sequence (RNA-strand)
  terminator -16.7 1580801 1580834 taactaaaccTTCATGCGGCGGATTTTTCCGCCGCCTTATTGAgcgagatagc
Notes: "The provided "Sequence" is that of the RNA strand, i.e. U's are shown instead of T's and regulators on the reverse strand will appear as the reverse complement of the sequence delimited by LeftPos-RigtPos"
