RegulonDB RegulonDB 11.0: Operon Form

ldtC operon and associated TUs in Escherichia coli K-12 genome

Name: ldtC
This page displays every known transcription unit of this operon and their known regulation.

Transcription unit          
Name: ldtC
Gene(s): ldtC   Genome Browser M3D Gene expression COLOMBOS
Evidence: [ICWHO] Inferred computationally without human oversight
Name: ldtCp
+1: 1170417
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 43
Sequence: ttacaaattctttgcacttccctgcactatccgacactgtcaccatccataattcaggctTatctgtttattacaataacc
                      -35                       -10         +1                   
Evidence: [HIPP]
Reference(s): [1] Huerta AM., et al., 2003
[2] Yamamoto K., et al., 2006
TF binding sites (TFBSs)
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal CpxR-phosphorylated activator ldtCp 1170463 1170479 -53.5 catctgcaacATTTACAAATTCTTTGCacttccctgc nd [APIORCISFBSCS], [BPP] [2]
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA MicA ldtC repressor 1170356 1170383 AACGCGUUUUGAUCAUCACCAAAAAUCC nd [IEP] [3]
