RegulonDB RegulonDB 10.9: Operon Form
   

ldtC operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: ldtC
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: ldtC
Gene(s): ldtC   Genome Browser M3D Gene expression COLOMBOS
Evidence: [ICWHO] Inferred computationally without human oversight
Promoter
Name: ldtCp
+1: 1170417
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 43
Sequence: ttacaaattctttgcacttccctgcactatccgacactgtcaccatccataattcaggctTatctgtttattacaataacc
                      -35                       -10         +1                   
Evidence: [HIPP]
[ICWHO]
[TIM]
Reference(s): [1] Huerta AM., et al., 2003
[2] Yamamoto K., et al., 2006
TF binding sites (TFBSs)
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal CpxR-Phosphorylated1 activator ldtCp 1170463 1170479 -53.5 catctgcaacATTTACAAATTCTTTGCacttccctgc nd [APIORCISFBSCS], [BPP] [2]
Note(s): 1The consensus of this CpxR-binding site is not located in the same DNA strand as in the ycfSp promoter Yamamoto K,20061The consensus of this CpxR-binding site is not located in the same DNA strand as in the ycfSp promoter Yamamoto K,2006
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA MicA ldtC repressor 1170356 1170383 AACGCGUUUUGAUCAUCACCAAAAAUCC nd [IEP] [3]





RegulonDB