RegulonDB RegulonDB 11.1: Operon Form

dgcM operon and associated TUs in Escherichia coli K-12 genome

Name: dgcM
This page displays every known transcription unit of this operon and their known regulation.

Transcription unit       
Name: ydaM
Gene(s): dgcM   Genome Browser M3D Gene expression COLOMBOS
Note(s): Expression of ydaM is dependent on σS under a number of stress conditions. H-NS plays
a role in regulating ydaM expression Weber H,2006.
Evidence: [COMP-AINF-SINGLE-DIRECTON] Automated inference that a single-gene directon is a transcription unit
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA OmrA ydaM repressor 1407768 1407779 CCAGGGUAUUGA TRANSLATION-BLOCKING [EXP-IMP-SITE-MUTATION] [1]
small regulatory RNA RprA ydaM repressor 1407759 1407793 UGAGUAAGUCCAGGGUAUUGAAGUUGUGCGUAAUC nd [EXP-IEP], [EXP-IMP-SITE-MUTATION] [2]
small regulatory RNA OmrB ydaM repressor 1407768 1407779 CCAGGGUAUUGA TRANSLATION-BLOCKING [EXP-IMP-SITE-MUTATION] [1]
