![]() ![]() ![]() |
Name: | ydaM | |||||||
Gene(s): | dgcM Genome Browser M3D Gene expression COLOMBOS | |||||||
Note(s): | Expression of ydaM is dependent on σS under a number of stress conditions. H-NS plays a role in regulating ydaM expression Weber H,2006. |
|||||||
Evidence: | [COMP-AINF-SINGLE-DIRECTON] Automated inference that a single-gene directon is a transcription unit |
sRNA | TU Regulated | Function | Binding Sites | Regulatory Mechanism | Evidence (Confirmed, Strong, Weak) | Reference(s) | ||
---|---|---|---|---|---|---|---|---|
PosLeft | PosRight | Target sequence (mRNA) | ||||||
small regulatory RNA OmrA | ydaM | repressor | 1407768 | 1407779 | CCAGGGUAUUGA | TRANSLATION-BLOCKING | [EXP-IMP-SITE-MUTATION] | [1] |
small regulatory RNA RprA | ydaM | repressor | 1407759 | 1407793 | UGAGUAAGUCCAGGGUAUUGAAGUUGUGCGUAAUC | nd | [EXP-IEP], [EXP-IMP-SITE-MUTATION] | [2] |
small regulatory RNA OmrB | ydaM | repressor | 1407768 | 1407779 | CCAGGGUAUUGA | TRANSLATION-BLOCKING | [EXP-IMP-SITE-MUTATION] | [1] |
Reference(s) |
![]() |
---|---|