RegulonDB RegulonDB 10.9: Operon Form

tolB-pal-cpoB operon and associated TUs in Escherichia coli K-12 genome

Name: tolB-pal-cpoB
This page displays every known transcription unit of this operon and their known regulation.

Transcription unit       
Name: tolB-pal-ybgF
Gene(s): tolB, pal, cpoB   Genome Browser M3D Gene expression COLOMBOS
Evidence: [PM] Polar mutation
Reference(s): [1] Vianney A., et al., 1996
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA MicA tolB-pal-ybgF repressor 779090 779109 AGGGCUGAUGAUUGCUCUGC nd [IEP] [2]

RNA cis-regulatory element    
Regulation, transcriptional elongation  
Attenuator type: Transcriptional
Strand: forward
Evidence: [ICA] Inferred by computational analysis
Reference(s): [3] Merino E, et al., 2005
  Structure type Energy LeftPos RightPos Sequence (RNA-strand)
  terminator -8.1 777644 777689 acatcaggcaCCGGTTGCCACGGGGTTCTGGTAGTTTTGTGTATTTTAGTTTGTTaacattctgc
  anti-terminator -3.4 777641 777653 tcaacatcagGCACCGGTTGCCacggggttct
  anti-anti-terminator -19.9 777602 777648 gacttcaaacCGTAATCGCGATGTTGACTGTTCGGACGGTCAACATCAGGCACCGGttgccacggg
Notes: "The provided "Sequence" is that of the RNA strand, i.e. U's are shown instead of T's and regulators on the reverse strand will appear as the reverse complement of the sequence delimited by LeftPos-RigtPos"
REGULATION, RNA cis-regulatory element:  
Rfam type: Cis-reg
Strand: forward
Evidence: [ICA] Inferred by computational analysis
Reference(s): [4] null null
  Description Rfam score Left Pos Right Pos Sequence (RNA-strand)
Notes: "The provied "Sequence" is that of the RNA strand, i.e. U's are shown instead of T's and regulators on the reverse strand will appears as the reverse complement of the sequence delimited by LeftPos-RightPos"
