RegulonDB RegulonDB 10.9: Operon Form
   

yliM-ompX operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: yliM-ompX
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit       
Name: yliM-ompX
Gene(s): yliM, ompX   Genome Browser M3D Gene expression COLOMBOS
Evidence: [AISGDTU] Automated inference that a single-gene directon is a transcription unit
[LTED] Length of transcript experimentally determined
Reference(s): [1] De Lay N., et al., 2009
[2] Mecsas J., et al., 1995
Promoter
Name: yliMp
+1: 850209
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 123
Sequence: atacccaatgctggttgagcatttgttgaaaaaattttcccccgttttgactaaaatgcgCcaggattgatggaatcatta
                          -35                       -10     +1                   
Note(s): ompXp1 is not transcribed by Eσ70 in vitro, although there are sequences similar to this sigma factor near the start site of transcription Mecsas J,1995
Evidence: [ICWHO]
[TIM]
Reference(s): [3] Huerta AM., et al., 2003
[2] Mecsas J., et al., 1995
Terminator(s)
Type: rho-independent
Sequence: tggtgatataAAAAATCCGCCTCTCGGGGCGGATTTTTgtttttaagg
Reference(s): [2] Mecsas J., et al., 1995
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA CyaR yliM-ompX repressor 850441 850451 GAGGUGGUUAU MRNA-DEGRADATION [IHBCE], [IMP] [1], [4]
small regulatory RNA MicA yliM-ompX repressor 850450 850472 AUGAAAAAAAUUGCAUGUCUUUC nd [IMP], [SM] [4], [5]


Transcription unit          
Name: ompX
Gene(s): ompX   Genome Browser M3D Gene expression COLOMBOS
Note(s): The expression of the ompX gene is affected by antibiotic pressure. An increase in ompX expression is maintained during exposure to increasing concentrations of tetracycline 17426813
Evidence: [AISGDTU] Automated inference that a single-gene directon is a transcription unit
[BTEI] Boundaries of transcription experimentally identified
[LTED] Length of transcript experimentally determined
Reference(s): [1] De Lay N., et al., 2009
[2] Mecsas J., et al., 1995
Promoter
Name: ompXp2
+1: 850419
Distance from start of the gene: 31
Sequence: cccgttagacatcacaaatcgcgaagagtttcccattaatttttgatatatttaaaacttAggacttatttgaatcacatt
Note(s):
The ompXp promoter appears to be negatively regulated by σE. In agreement with this, a consensus sequence for RNA polymerase-σE binding is located upstream of this promoter, but in the opposite direction from ompX Rhodius VA,2005.
Evidence: [HTTIM]    
[RS-EPT-CBR]
[TIM]
Reference(s): [2] Mecsas J., et al., 1995
[6] Mendoza-Vargas A., et al., 2009
[7] Salgado H, et al., 2012
Terminator(s)
Type: rho-independent
Sequence: tggtgatataAAAAATCCGCCTCTCGGGGCGGATTTTTgtttttaagg
Reference(s): [2] Mecsas J., et al., 1995
TF binding sites (TFBSs)
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd FNR1 repressor ompXp2 nd nd nd nd nd [BPP], [GEA], [IGI] [8]
Note(s): 1By making use of microarray analysis, Constantinidou et al. Constantinidou C,2006 concluded that FNR represses ompX gene expression. They also identified a putative FNR-binding site upstream of the gene, but the sequence was not shown1By making use of microarray analysis, Constantinidou et al. Constantinidou C,2006 concluded that FNR represses ompX gene expression. They also identified a putative FNR-binding site upstream of the gene, but the sequence was not shown
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA CyaR ompX repressor 850441 850451 GAGGUGGUUAU MRNA-DEGRADATION [IHBCE], [IMP] [1], [4]
small regulatory RNA MicA ompX repressor 850450 850472 AUGAAAAAAAUUGCAUGUCUUUC nd [IMP], [SM] [4], [5]




Reference(s)    

 [1] De Lay N., Gottesman S., 2009, The Crp-activated small noncoding regulatory RNA CyaR (RyeE) links nutritional status to group behavior., J Bacteriol 191(2):461-76

 [2] Mecsas J., Welch R., Erickson JW., Gross CA., 1995, Identification and characterization of an outer membrane protein, OmpX, in Escherichia coli that is homologous to a family of outer membrane proteins including Ail of Yersinia enterocolitica., J Bacteriol 177(3):799-804

 [3] Huerta AM., Collado-Vides J., 2003, Sigma70 promoters in Escherichia coli: specific transcription in dense regions of overlapping promoter-like signals., J Mol Biol 333(2):261-78

 [4] Johansen J., Eriksen M., Kallipolitis B., Valentin-Hansen P., 2008, Down-regulation of Outer Membrane Proteins by Noncoding RNAs: Unraveling the cAMP-CRP- and sigma(E)-Dependent CyaR-ompX Regulatory Case., J Mol Biol 383(1):1-9

 [5] Gogol EB., Rhodius VA., Papenfort K., Vogel J., Gross CA., 2011, Small RNAs endow a transcriptional activator with essential repressor functions for single-tier control of a global stress regulon., Proc Natl Acad Sci U S A 108(31):12875-80

 [6] Mendoza-Vargas A., Olvera L., Olvera M., Grande R., Vega-Alvarado L., Taboada B., Jimenez-Jacinto V., Salgado H., Juarez K., Contreras-Moreira B., Huerta AM., Collado-Vides J., Morett E., 2009, Genome-wide identification of transcription start sites, promoters and transcription factor binding sites in E. coli., PLoS One 4(10):e7526

 [7] Salgado H, Peralta-Gil M, Gama-Castro S, Santos-Zavaleta A, Muñiz-Rascado L, García-Sotelo JS, Weiss V, Solano-Lira H, Martínez-Flores I, Medina-Rivera A, Salgado-Osorio G, Alquicira-Hernández S, Alquicira-Hernández K, López-Fuentes A, Porrón-Sotelo L, Huerta AM, Bonavides-Martínez C, Balderas-Martínez YI, Pannier L, Olvera M, Labastida A, Jiménez-Jacinto V, Vega-Alvarado L, Del Moral-Chávez V, Hernández-Alvarez A, Morett E, Collado-Vides J., 2012, RegulonDB v8.0: omics data sets, evolutionary conservation, regulatory phrases, cross-validated gold standards and more., Nucleic Acids Res.

 [8] Constantinidou C., Hobman JL., Griffiths L., Patel MD., Penn CW., Cole JA., Overton TW., 2006, A reassessment of the FNR regulon and transcriptomic analysis of the effects of nitrate, nitrite, NarXL, and NarQP as Escherichia coli K12 adapts from aerobic to anaerobic growth., J Biol Chem 281(8):4802-15


RegulonDB