RegulonDB RegulonDB 10.9: Operon Form
   

nfeF operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: nfeF
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: nfeF
Synonym(s): yqjH
Gene(s): nfeF   Genome Browser M3D Gene expression COLOMBOS
Note(s): FUR is a regulator that binds cooperatively, on different faces of the DNA Chen Z,2007. 12644489, in the promoter regions; according to the sequence identified by Wang et al. in 2011 (GATTAACAATCATTATCATTT), it is possible that this regulator interacts with three binding sites in different positions Wang S,2011.
A potential RNA G-quadruplex structure, formed by guanine-rich sequences located in the coding sequence region of the gene, was identified for nfeF . This structure could regulate the expression of the gene, as observed for hemL gene expression 31964733.
Evidence: [AISGDTU] Automated inference that a single-gene directon is a transcription unit
Reference(s): [1] Panina EM., et al., 2001
Promoter
Name: yqjHp
+1: 3216538
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 47
Sequence: tagacatatcagttctacaaatcgcttgcatttatcatgattaacaatcattatcatttgCgagttttatttagatatatc
                          -35                       -10     +1                   
Evidence: [HIPP]
[ICWHO]
[IHBCE]
Reference(s): [2] Huerta AM., et al., 2003
[3] Wang S., et al., 2011
TF binding sites (TFBSs)
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal Fur-Fe2+ repressor yqjHp 3216538 3216556 -9.0 ttatcatgatTAACAATCATTATCATTTGCgagttttatt nd [AIBSCS], [APIORCISFBSCS], [GEA] [3], [4]
proximal Fur-Fe2+ repressor yqjHp 3216544 3216562 -15.0 ttgcatttatCATGATTAACAATCATTATCatttgcgagt nd [AIBSCS], [APIORCISFBSCS], [GEA] [3], [4]
proximal Fur-Fe2+ repressor yqjHp 3216548 3216566 -19.0 tcgcttgcatTTATCATGATTAACAATCATtatcatttgc nd [AIBSCS], [APIORCISFBSCS], [GEA] [3], [4]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal NfeR1 repressor yqjHp 3216512 3216531 18.0 ttgcgagtttTATTTAGATATATCTGATTAccatcacgaa nd [APIORCISFBSCS], [BPP], [GEA], [SM] [3], [5]
Note(s): 1There is communication over a distance of 200 bp between site I, associated with the yqjIp promoter, and site II, which is associated with the yqjHp promoter, that provides full YqjI-dependent regulation at two target promoters Wang S,2014

There are two repetitive extragenic palindromic (REP) sequences within the yqjH-yqjI intergenic region; these REP sequences are not required for YqjI regulation Wang S,20144There is communication over a distance of 200 bp between site I, associated with the yqjIp promoter, and site II, which is associated with the yqjHp promoter, that provides full YqjI-dependent regulation at two target promoters Wang S,2014

There are two repetitive extragenic palindromic (REP) sequences within the yqjH-yqjI intergenic region; these REP sequences are not required for YqjI regulation Wang S,2014





RegulonDB