RegulonDB RegulonDB 10.9:Regulon Page
   

Rob DNA-binding transcriptional dual regulator

Synonyms: Rob
Summary:
Rob is a transcriptional dual regulator. Its N-terminal domain shares 49% identity with MarA and SoxS [16] These proteins activate a common set of about 50 target genes [3, 17] the marA/soxS/rob regulon, involved in antibiotic resistance [1, 18] superoxide resistance [7, 19] and tolerance to organic solvents []and heavy metals [] The activity of each protein is induced by different signals: the activity of Rob is increased with dipyridyl, bile salts, or decanoate [4] and the activities of MarA and SoxS are increased by the aromatic weak acid salicylate [17]and oxidative stress [] respectively.
Read more >


Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
Rob Functional   [IE] [1], [2]
Evolutionary Family: AraC/XylS
Connectivity class: Local Regulator
Gene name: rob
  Genome position: 4634441-4635310
  Length: 870 bp / 289 aa
Operon name: rob
TU(s) encoding the TF:
Transcription unit        Promoter
rob
robp


Regulon       
Regulated gene(s) acnA, acrA, acrB, acrZ, aldA, aslB, fumC, inaA, ldtB, marA, marB, marR, micF, mltF, nfo, nfsA, nfsB, rimK, rob, sodA, tolC, ybjC, ybjN, ygiB, ygiC, zwf
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
drug resistance/sensitivity (7)
adaptations (3)
Transcription related (3)
detoxification (3)
TCA cycle (2)
Read more >
Regulated operon(s) acrAB, acrZ, aldA, aslB, fumAC, inaA, ldtB, marRAB, micF, mltF, nfo, nfsB, rob, sodA, tolC-ygiBC, ybjC-nfsA-rimK-ybjN, ymiC-acnA, zwf
First gene in the operon(s) acnA, acrA, acrZ, aldA, aslB, fumC, inaA, ldtB, marR, micF, mltF, nfo, nfsB, rob, sodA, tolC, ybjC, zwf
Simple and complex regulons AcrR,CRP,CpxR,Cra,Fis,MarA,MarR,Rob,SoxS
AcrR,EnvR,MarA,MprA,PhoP,Rob,SoxS
AcrR,H-NS,HU,IHF,Lrp,MarA,OmpR,Rob,SoxS
ArcA,CRP,Cra,FNR,MarA,Rob,SoxS
ArcA,CRP,DnaA,FNR,MarA,Rob,SoxS
Read more >
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)
[Rob,-](1)
[Rob,+](19)


Transcription factor regulation    


Transcription factor binding sites (TFBSs) arrangements
      

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence
LeftPos RightPos Evidence (Confirmed, Strong, Weak) References
  Rob activator acnAp2 Sigma70 -51.5 -101.5 acnA
aaggtttctcCTCTTTTATCAATTTGGGTTGttatcaaatc
1335720 1335740 [APIORCISFBSCS], [BPP], [CEEUMA], [GEA], [IHBCE], [RSE] [3]
  Rob activator acrAp Sigma70 nd nd acrA, acrB nd nd [BPP], [GEA], [IGI] [4]
  Rob activator acrZp Sigma70 -40.5 -62.5 acrZ
cgcaaagctgACCGCACAAAAGGGGAGTGCTtttctgtgct
794701 794720 [GEA], [IHBCE] [5]
  Rob activator aldAp Sigma70 -161.0 -203.0 aldA
gcgatggaaaGTCGCTCGTTACGTTAAAAATtgcccgtttg
1488019 1488038 [AIBSCS], [GEA] [3]
  Rob activator aslBp Sigma54 nd nd aslB nd nd [BPP], [GEA], [IGI] [6]
  Rob activator fumCp1 Sigma70 -35.5 -101.5 fumC
ggtttttttaCATGGCACGAAAGACCAAACAtttgttatca
1686680 1686699 [BPP], [GEA], [IEP] [7], [8]
  Rob activator inaAp Sigma70 -41.5 -68.5 inaA
aattcattaaTACGACACGTTTCATTAAGATtttcctcagg
2349531 2349550 [APIORCISFBSCS], [BPP], [GEA] [6], [9]
  Rob activator ldtBp nd nd nd ldtB nd nd [BPP], [GEA], [IGI] [6]
  Rob activator marRp Sigma70 -61.5 -88.5 marR, marA, marB
acttgaaccgATTTAGCAAAACGTGGCATCGgtcaattcat
1619022 1619041 [APIORCISFBSCS], [BPP], [GEA], [SM] [6], [9], [10]
  Rob activator micFp Sigma70 -40.0 -40.0 micF
aagtatttgaCAGCACTGAATGTCAAAACAAaaccttcact
2313034 2313053 [APIORCISFBSCS], [BPP], [GEA] [11]
  Rob activator micFp2 Sigma38 -40.0 -40.0 micF
aagtatttgaCAGCACTGAATGTCAAAACAAaaccttcact
2313034 2313053 [APIORCISFBSCS], [BPP], [GEA] [11]
  Rob activator mltFp Sigma70 nd nd mltF nd nd [BPP], [GEA], [IGI] [6]
  Rob activator nfop Sigma70 -38.5 -72.5 nfo
tcaaagcgtcATCGCATAAACCACTACATCTtgctcctgtt
2250758 2250777 [APIORCISFBSCS], [GEA] [1], [9]
  Rob activator nfsBp Sigma70 -43.5 -72.5 nfsB
agcggaaatcTATAGCGCATTTTTCTCGCTTaccatttctc
605487 605507 [APIORCISFBSCS], [BPP], [GEA] [3]
  Rob repressor robp nd -19.5 -63.0 rob
cactgaatgcTAAAACAGCAAAAAATGCTATtatccaatta
4635363 4635382 [APIORCISFBSCS], [BPP], [GEA], [SM] [12]
  Rob activator sodAp Sigma70 -40.5 -91.5 sodA
tacgaaaagtACGGCATTGATAATCATTTTCaatatcattt
4100709 4100728 [APIORCISFBSCS], [BPP] [1]
  Rob activator tolCp3 nd -40.5 -93.5 tolC, ygiB, ygiC
ttaacgccctATGGCACGTAACGCCAACCTTttgcggtagc
3178012 3178032 [AIBSCS], [GEA], [AIBSCS], [GEA] [13], [14], [15]
  Rob activator tolCp4 Sigma38 -52.5 -93.5 tolC, ygiB, ygiC
ttaacgccctATGGCACGTAACGCCAACCTTttgcggtagc
3178012 3178032 [AIBSCS], [GEA] [15]
  Rob activator ybjCp Sigma70 -40.5 -61.5 ybjC, nfsA, rimK, ybjN
ttaattgctaAAAGCTATAACTGTTAAACACaatacagtga
890842 890861 [AIBSCS], [APIORCISFBSCS], [CEEUMA], [GEA], [RSE] [3]
  Rob activator zwfp Sigma70 -54.0 -116.0 zwf
cgcttttcccGTAATCGCACGGGTGGATAAGcgtttacagt
1936420 1936439 [APIORCISFBSCS], [BPP], [GEA] [1], [7]



High-throughput Transcription factor binding sites (TFBSs)
      

  Functional conformation Function Object name Object type Distance to first Gene Sequence LeftPos RightPos Center Position Growth Condition Evidence (Confirmed, Strong, Weak) References
  Rob activator mdaB Transcription-Unit nd
cgcaaaagacTTTGCACATTTTGCTAATTTcaccgtaccg
3172452 3172471 3172462.0 nd [AIBSCS], [GEA] [3]
  Rob activator map-glnD-dapD Transcription-Unit nd
aaaaccttcaGTGGCACGTTTGGCGAAATTcagaatgatt
189597 189616 189607.0 nd [AIBSCS], [GEA] [3]
  Rob activator yhbW Transcription-Unit nd
gcctaagtaaATAGCTCACTTTGTTAACAActttaactac
3303372 3303391 3303382.0 nd [AIBSCS], [GEA] [3]


Alignment and PSSM for Rob TFBSs    

Aligned TFBS of Rob   
  Sequence
  AGGTTGGCGTTACGTGCCATAGG
  GTTTTGACATTCAGTGCTGTCAA
  GATTTAGCAAAACGTGGCATCGG
  TGTTTGGTCTTTCGTGCCATGTA
  ATAATAGCATTTTTTGCTGTTTT
  CGCTTATCCACCCGTGCGATTAC
  ATCTTAATGAAACGTGTCGTATT
  TTTTTAACGTAACGAGCGACTTT
  CTTTTATCAATTTGGGTTGTTAT
  GCACTCCCCTTTTGTGCGGTCAG
  GATGTAGTGGTTTATGCGATGAC
  TGTTTAACAGTTATAGCTTTTAG
  AAAATGATTATCAATGCCGTACT
  AAGCGAGAAAAATGCGCTATAGA

Position weight matrix (PWM). Rob matrix-quality result   
A	5	4	3	2	0	9	5	1	6	6	4	5	3	2	2	0	0	0	7	0	4	6	3
C	2	1	2	2	0	1	1	9	3	0	1	3	6	0	1	0	11	5	0	1	3	1	2
G	4	4	2	1	1	4	6	0	4	2	0	0	0	10	1	14	1	4	6	0	2	3	4
T	3	5	7	9	13	0	2	4	1	6	9	6	5	2	10	0	2	5	1	13	5	4	5

Consensus   
;	consensus.strict             	ggttTagCaattcGtGCcgTtag
;	consensus.strict.rc          	CTAACGGCACGAATTGCTAAACC
;	consensus.IUPAC              	rkttTrrCvwthyGtGCbrTyrk
;	consensus.IUPAC.rc           	MYRAYVGCACRDAWBGYYAAAMY
;	consensus.regexp             	[ag][gt]ttT[ag][ag]C[acg][at]t[act][ct]GtGC[cgt][ag]T[ct][ag][gt]
;	consensus.regexp.rc          	[AC][CT][AG]A[CT][ACG]GCAC[AG][AGT]A[AT][CGT]G[CT][CT]AAA[AC][CT]

PWM logo   


 


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation




Reference(s)    

 [1] Ariza RR., Li Z., Ringstad N., Demple B., 1995, Activation of multiple antibiotic resistance and binding of stress-inducible promoters by Escherichia coli Rob protein., J Bacteriol 177(7):1655-61

 [2] Skarstad K., Thony B., Hwang DS., Kornberg A., 1993, A novel binding protein of the origin of the Escherichia coli chromosome., J Biol Chem 268(8):5365-70

 [3] Martin RG., Rosner JL., 2002, Genomics of the marA/soxS/rob regulon of Escherichia coli: identification of directly activated promoters by application of molecular genetics and informatics to microarray data., Mol Microbiol 44(6):1611-24

 [4] Rosenberg EY., Bertenthal D., Nilles ML., Bertrand KP., Nikaido H., 2003, Bile salts and fatty acids induce the expression of Escherichia coli AcrAB multidrug efflux pump through their interaction with Rob regulatory protein., Mol Microbiol 48(6):1609-19

 [5] Hobbs EC., Yin X., Paul BJ., Astarita JL., Storz G., 2012, Conserved small protein associates with the multidrug efflux pump AcrB and differentially affects antibiotic resistance., Proc Natl Acad Sci U S A 109(41):16696-701

 [6] Bennik MH., Pomposiello PJ., Thorne DF., Demple B., 2000, Defining a rob regulon in Escherichia coli by using transposon mutagenesis., J Bacteriol 182(13):3794-801

 [7] Jair KW., Yu X., Skarstad K., Thony B., Fujita N., Ishihama A., Wolf RE., 1996, Transcriptional activation of promoters of the superoxide and multiple antibiotic resistance regulons by Rob, a binding protein of the Escherichia coli origin of chromosomal replication., J Bacteriol 178(9):2507-13

 [8] Taliaferro LP., Keen EF., Sanchez-Alberola N., Wolf RE., 2012, Transcription Activation by Escherichia coli Rob at Class II Promoters: Protein-Protein Interactions between Rob's N-Terminal Domain and the σ(70) Subunit of RNA Polymerase., J Mol Biol 419(3-4):139-57

 [9] Martin RG., Gillette WK., Rhee S., Rosner JL., 1999, Structural requirements for marbox function in transcriptional activation of mar/sox/rob regulon promoters in Escherichia coli: sequence, orientation and spatial relationship to the core promoter., Mol Microbiol 34(3):431-41

 [10] Martin RG., Rosner JL., 1997, Fis, an accessorial factor for transcriptional activation of the mar (multiple antibiotic resistance) promoter of Escherichia coli in the presence of the activator MarA, SoxS, or Rob., J Bacteriol 179(23):7410-9

 [11] Kwon HJ., Bennik MH., Demple B., Ellenberger T., 2000, Crystal structure of the Escherichia coli Rob transcription factor in complex with DNA., Nat Struct Biol 7(5):424-30

 [12] Schneiders T., Levy SB., 2006, MarA-mediated transcriptional repression of the rob promoter., J Biol Chem 281(15):10049-55

 [13] Aono R., Tsukagoshi N., Yamamoto M., 1998, Involvement of outer membrane protein TolC, a possible member of the mar-sox regulon, in maintenance and improvement of organic solvent tolerance of Escherichia coli K-12., J Bacteriol 180(4):938-44

 [14] Rodionov DA., Gelfand MS., Mironov AA., Rakhmaninova AB., 2001, Comparative approach to analysis of regulation in complete genomes: multidrug resistance systems in gamma-proteobacteria., J Mol Microbiol Biotechnol 3(2):319-24

 [15] Zhang A., Rosner JL., Martin RG., 2008, Transcriptional activation by MarA, SoxS and Rob of two tolC promoters using one binding site: a complex promoter configuration for tolC in Escherichia coli., Mol Microbiol 69(6):1450-5

 [16] Cohen SP., Hachler H., Levy SB., 1993, Genetic and functional analysis of the multiple antibiotic resistance (mar) locus in Escherichia coli., J Bacteriol 175(5):1484-92

 [17] Pomposiello PJ., Bennik MH., Demple B., 2001, Genome-wide transcriptional profiling of the Escherichia coli responses to superoxide stress and sodium salicylate., J Bacteriol 183(13):3890-902

 [18] Martin RG., Jair KW., Wolf RE., Rosner JL., 1996, Autoactivation of the marRAB multiple antibiotic resistance operon by the MarA transcriptional activator in Escherichia coli., J Bacteriol 178(8):2216-23

 [19] Nunoshiba T., Hidalgo E., Amabile Cuevas CF., Demple B., 1992, Two-stage control of an oxidative stress regulon: the Escherichia coli SoxR protein triggers redox-inducible expression of the soxS regulatory gene., J Bacteriol 174(19):6054-60

 [20] Pomposiello PJ., Koutsolioutsou A., Carrasco D., Demple B., 2003, SoxRS-regulated expression and genetic analysis of the yggX gene of Escherichia coli., J Bacteriol 185(22):6624-32

 [21] Wood TI., Griffith KL., Fawcett WP., Jair KW., Schneider TD., Wolf RE., 1999, Interdependence of the position and orientation of SoxS binding sites in the transcriptional activation of the class I subset of Escherichia coli superoxide-inducible promoters., Mol Microbiol 34(3):414-30

 [22] Dangi B., Pelupessey P., Martin RG., Rosner JL., Louis JM., Gronenborn AM., 2001, Structure and dynamics of MarA-DNA complexes: an NMR investigation., J Mol Biol 314(1):113-27

 [23] Griffith KL., Wolf RE., 2001, Systematic mutagenesis of the DNA binding sites for SoxS in the Escherichia coli zwf and fpr promoters: identifying nucleotides required for DNA binding and transcription activation., Mol Microbiol 40(5):1141-54

 [24] Gallegos MT., Schleif R., Bairoch A., Hofmann K., Ramos JL., 1997, Arac/XylS family of transcriptional regulators., Microbiol Mol Biol Rev 61(4):393-410

 [25] Zhang C., Chen S., Bai X., Dedkova LM., Hecht SM., 2020, Alteration of Transcriptional Regulator Rob In Vivo: Enhancement of Promoter DNA Binding and Antibiotic Resistance in the Presence of Nucleobase Amino Acids., Biochemistry 59(12):1217-1220



RegulonDB