RegulonDB RegulonDB 11.0:Regulon Page
   

OxyR DNA-binding transcriptional dual regulator

Synonyms: OxyR
Summary:
OxyR, "oxidative stress regulator," is the transcriptional dual regulator for the expression of antioxidant genes in response to oxidative stress, in particular, elevated levels of hydrogen peroxide. The OxyR regulon includes genes involved in peroxide metabolism, redox balance, and peroxide protection by, for example, manganese uptake [14, 19, 33, 34]. Moreover, OxyR activates the synthesis of the small, noncoding oxyS RNA. This allows OxyR to regulate as many as 40 additional gene products indirectly by affecting mRNA stability or translation efficiency [35]. OxyR acts as a repressor for its own synthesis in both the oxidized and reduced forms [21, 36]. Accordingly, point mutations observed in oxyR as a result of adaptive evolution under high iron conditions lead to increased expression levels of OxyR-regulated genes, also termed the OxyR i-modulon [37]. For more information on i-modulons, see [38].
Read more >


Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
OxyR Functional   nd nd
Evolutionary Family: LysR
TFBs length: 17
TFBs symmetry: inverted-repeat
Sensing class: Using internal synthesized signals
Connectivity class: Local Regulator
Gene name: oxyR
  Genome position: 4158490-4159407
  Length: 918 bp / 305 aa
Operon name: oxyR
TU(s) encoding the TF:
Transcription unit        Promoter
oxyR
oxyRp
oxyR
oxyRp2


Regulon       
Regulated gene(s) ahpC, ahpF, ccp, dps, dsbG, elaB, fhuF, flu, fur, gntP, gor, grxA, hcp, hcr, hemF, hemH, isrC, katG, metE, metR, mntH, nfsA, oxyR, oxyS, poxB, rimK, sufA, sufB, sufC, sufD, sufE, sufS, trxC, uof, uxuA, uxuB, ybjC, ybjN, ychF, yjjZ, zinT, znuA, znuB, znuC
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
incorporation of metal ions (6)
sulfur metabolism (6)
detoxification (4)
membrane (4)
Transcription related (3)
Read more >
Regulated operon(s) ahpCF, amiA-hemF, ccp, dps, dsbG, elaB, fhuF, fldA-uof-fur, gntP, gor, grxA, hcp-hcr-poxB-ltaE-ybjT, hemH, isrC-flu, katG, metE, metR, mntH, oxyR, oxyS, pth-ychF, sufABCDSE, trxC, uxuAB, ybjC-nfsA-rimK-ybjN, yjjZ, zinT, znuA, znuCB
First gene in the operon(s) ahpC, dps, elaB, fhuF, gntP, gor, grxA, hcp, hemF, hemH, isrC, katG, metE, metR, mntH, oxyR, oxyS, sufA, trxC, uof, uxuA, ybjC, ychF, ccp, yjjZ, zinT, znuA, znuC, dsbG
Simple and complex regulons CRP,ExuR,OxyR,UxuR
CRP,OxyR
CRP,OxyR,UxuR
DksA,OxyR,YdcI,ppGpp
FNR,Fur,OxyR
Read more >
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)
[OxyR,-](9)
[OxyR,+](25)


Transcription factor regulation    


Transcription factor binding sites (TFBSs) arrangements
      

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence LeftPos RightPos Growth Conditions Evidence (Confirmed, Strong, Weak) References
  OxyR activator ahpCp1 Sigma70 -66.0 -90.0 ahpC, ahpF
tacgaaggttGTAAGGTAAAACTTATCgatttgataa
638847 638863 nd [GEA], [APIORCISFBSCS], [BPP] [1], [2], [3], [4], [5]
  OxyR activator ahpCp1 Sigma70 -44.0 -68.0 ahpC, ahpF
ttatcgatttGATAATGGAAACGCATTagccgaatcg
638869 638885 nd [GEA], [APIORCISFBSCS], [BPP] [1], [2], [3], [4], [5], [6]
  OxyR activator ahpCp2 Sigma70 -76.0 -328.0 ahpC, ahpF
aaagtcgagtAAAAGGCATAACCTATCactgtcatag
638609 638625 nd [GEA], [APIORCISFBSCS], [BPP] [5]
  OxyR activator ahpCp2 Sigma70 -53.0 -305.0 ahpC, ahpF
tatcactgtcATAGGTAAGAGCTTAGAtcaggtgatt
638632 638648 nd [GEA], [RSE], [APIORCISFBSCS], [BPP], [CSEUMA], [IHBCE] [5], [7]
  OxyR activator dpsp Sigma70 -66.0 -105.0 dps
ttgtttttcaCGCTTGTTACCACTATTagtgtgatag
849008 849024 nd [APIORCISFBSCS]
  OxyR activator dpsp Sigma70 -44.0 -83.0 dps
ctattagtgtGATAGGAACAGCCAGAAtagcggaaca
848986 849002 nd [APIORCISFBSCS]
  OxyR activator dpsp Sigma70 -17.0 -56.0 dps
tagcggaacaCATAGCCGGTGCTATACttaatctcgt
848959 848975 nd [RSE], [CEEUMA], [IHBCE] [7]
  OxyR activator dpsp2 Sigma38 -66.0 -105.0 dps
ttgtttttcaCGCTTGTTACCACTATTagtgtgatag
849008 849024 nd [APIORCISFBSCS]
  OxyR activator dpsp2 Sigma38 -44.0 -83.0 dps
ctattagtgtGATAGGAACAGCCAGAAtagcggaaca
848986 849002 nd [APIORCISFBSCS]
  OxyR activator dpsp2 Sigma38 -17.0 -56.0 dps
tagcggaacaCATAGCCGGTGCTATACttaatctcgt
848959 848975 nd [RSE], [CEEUMA], [IHBCE] [7]
  OxyR activator dsbGp nd -77.0 -304.0 dsbG
cgattcggctAATGCGTTTCCATTATCaaatcgataa
638869 638885 nd [GEA], [APIORCISFBSCS], [BPP] [5], [6]
  OxyR activator dsbGp nd -55.0 -282.0 dsbG
ttatcaaatcGATAAGTTTTACCTTACaaccttcgta
638847 638863 nd [GEA], [APIORCISFBSCS], [BPP] [5]
  OxyR activator elaBp Sigma38 -31.0 -57.0 elaB
cacattgggaTGGCACGCGAGGTAATTCAGGCGTAATCAACAACCCTTGTCTATAGTtagtgacagg
2381061 2381107 nd [GEA], [APIORCISFBSCS], [BPP], [SM] [8]
  OxyR repressor elaBp Sigma38 -31.0 -57.0 elaB
cacattgggaTGGCACGCGAGGTAATTCAGGCGTAATCAACAACCCTTGTCTATAGTtagtgacagg
2381061 2381107 nd [GEA], [APIORCISFBSCS], [BPP], [SM] [8]
  OxyR repressor fhuFp1 Sigma70 -105.0 -136.0 fhuF
gtacgttgcaACATGATTTCATCTCTTtcattgataa
4605791 4605807 nd [GEA], [APIORCISFBSCS], [BPP] [5]
  OxyR repressor fhuFp1 Sigma70 -83.0 -114.0 fhuF
ctctttcattGATAATGATAACCAATAtcatatgata
4605769 4605785 nd [GEA], [APIORCISFBSCS], [BPP] [5]
  OxyR repressor fhuFp1 Sigma70 -21.0 -52.0 fhuF
aatcccttgcTATCGGGTAAACCTATCgctatgatta
4605707 4605723 nd [RSE], [CEEUMA], [IHBCE] [5], [7]
  OxyR repressor fhuFp1 Sigma70 2.0 -30.0 fhuF
ctatcgctatGATTAGCAATCATTATCatttagatta
4605685 4605701 nd [GEA], [RSE], [APIORCISFBSCS], [BPP], [CEEUMA], [IHBCE] [5], [7]
  OxyR repressor flup Sigma70 -26.0 -26.0 isrC, flu
actgtctctcTTGTCCGTGCAATAGCTcaataataga
2071283 2071299 nd [RSE], [CEEUMA], [IHBCE] [7]
  OxyR repressor flup Sigma70 2.0 2.0 isrC, flu
caataatagaATAAAACGATCAATATCtattttatcg
2071310 2071326 nd [GEA], [APIORCISFBSCS], [BPP], [SM] [9], [10], [11], [12], [13]
  OxyR repressor flup Sigma70 24.0 24.0 isrC, flu
atatctatttTATCGATCGTTTATATCgatcgataag
2071332 2071348 nd [GEA], [RSE], [APIORCISFBSCS], [BPP], [CEEUMA], [IHBCE], [SM] [7], [9], [10], [11], [12], [13]
  OxyR repressor gntPp Sigma70 -152.0 -190.0 gntP
cttttggtaaGACATGTCAACCCGAATtctgaaattg
4551478 4551494 nd [GEA], [APIORCISFBSCS] [14]
  OxyR repressor gntPp Sigma70 -130.0 -168.0 gntP
cgaattctgaAATTGGTTAACCACATCacaagaattt
4551456 4551472 nd [GEA], [APIORCISFBSCS] [14]
  OxyR activator gorp Sigma70 nd nd gor nd nd nd [GEA], [BPP] [15]
  OxyR activator gorp2 Sigma38 nd nd gor nd nd nd [GEA], [BPP] [15]
  OxyR activator grxAp nd -66.0 -89.0 grxA
gtttaacagtTATAGCTTTTAGCAATTaatgcaacag
890834 890850 nd [GEA], [RSE], [APIORCISFBSCS], [BPP], [CEEUMA], [IHBCE] [7], [14], [16]
  OxyR activator grxAp nd -44.0 -67.0 grxA
caattaatgcAACAGGTTAAACCTACTttcagcgaat
890812 890828 nd [GEA], [APIORCISFBSCS], [BPP] [14], [16]
  OxyR activator grxAp nd 8.0 -16.0 grxA
tcattacaggCATAAATCTATGAGGAGagaaataatg
890761 890777 nd [RSE], [CCEUMA], [IHBCE] [7]
  OxyR activator hcpp1 nd nd nd hcp, hcr, poxB nd nd nd [GEA], [BPP] [17]
  OxyR activator hemFp3 nd nd nd hemF nd nd nd [GEA], [BPP] [18]
  OxyR activator hemHp Sigma70 -55.0 -79.0 hemH
ctattcctttTTCTGATTTGACCTCTCacagcaatta
497968 497984 nd [GEA], [BPP] [14], [18]
  OxyR activator hemHp Sigma70 -33.0 -57.0 hemH
ctctcacagcAATTAGTTCTTCTTCCTcacttttccg
497990 498006 nd [GEA], [BPP] [14], [18]
  OxyR activator katGp Sigma70 -66.0 -89.0 katG
ccaacaatatGTAAGATCTCAACTATCgcatccgtgg
4133738 4133754 nd [GEA], [RSE], [APIORCISFBSCS], [BPP], [CEEUMA], [IHBCE] [2], [3], [4], [5], [6], [7]
  OxyR activator katGp Sigma70 -44.0 -67.0 katG
ctatcgcatcCGTGGATTAATTCAATTataacttctc
4133760 4133776 nd [GEA], [APIORCISFBSCS], [BPP] [2], [3], [4], [5], [6]
  OxyR activator katGp Sigma70 2.0 -22.0 katG
tgtgtatcgtAACGGTAACACTGTAGAggggagcaca
4133805 4133821 nd [RSE], [CEEUMA], [IHBCE] [7]
  OxyR activator metEp nd -42.0 -211.0 metE
cttcacttcgGCATGAATAATTTGCGCttgaggaata
4012834 4012850 nd [RSE], [CEEUMA], [IHBCE] [7]
  OxyR activator metRp1 nd -5.0 -44.0 metR
taattggcggTTACTGTATATTCCTCAagcgcaaatt
4012852 4012868 nd [RSE], [CEEUMA], [IHBCE] [7]
  OxyR activator mntHp Sigma70 -76.0 -104.0 mntH
ttttcgtagtCATAATCCTGGTCTATCagagaaatca
2512802 2512818 nd [GEA], [RSE], [APIORCISFBSCS], [CEEUMA], [IHBCE], [SM] [7], [19], [20]
  OxyR activator mntHp Sigma70 -54.0 -82.0 mntH
ctatcagagaAATCACCACAATCCATTtaaatgaatt
2512780 2512796 nd [GEA], [AIBSCS], [SM] [19], [20]
  OxyR repressor oxyRp Sigma70 -18.0 -51.0 oxyR
tgatagggatAATCGTTCATTGCTATTctacctatcg
4158431 4158447 nd [GEA], [APIORCISFBSCS], [BPP] [2], [4], [21], [22]
  OxyR repressor oxyRp Sigma70 5.0 -29.0 oxyR
ctattctaccTATCGCCATGAACTATCgtggcgatgg
4158453 4158469 nd [GEA], [RSE], [APIORCISFBSCS], [BPP], [CEEUMA], [IHBCE] [2], [7], [21], [22]
  OxyR repressor oxyRp2 Sigma38 -18.0 -51.0 oxyR
tgatagggatAATCGTTCATTGCTATTctacctatcg
4158431 4158447 nd [GEA], [APIORCISFBSCS], [BPP] [2], [4], [21], [22]
  OxyR repressor oxyRp2 Sigma38 5.0 -29.0 oxyR
ctattctaccTATCGCCATGAACTATCgtggcgatgg
4158453 4158469 nd [GEA], [RSE], [APIORCISFBSCS], [BPP], [CEEUMA], [IHBCE] [2], [7], [21], [22]
  OxyR activator oxySp Sigma70 -67.0 -67.0 oxyS
ccatcgccacGATAGTTCATGGCGATAggtagaatag
4158453 4158469 nd [GEA], [RSE], [APIORCISFBSCS], [BPP], [CEEUMA], [IHBCE] [4], [7], [22]
  OxyR activator oxySp Sigma70 -45.0 -45.0 oxyS
cgataggtagAATAGCAATGAACGATTatccctatca
4158431 4158447 nd [GEA], [APIORCISFBSCS], [BPP] [4], [22]
  OxyR activator sufAp Sigma70 -232.0 -264.0 sufA, sufB, sufC, sufD, sufS, sufE
tctgaacgctGCACTTTTTTACCTATCtcttaaatag
1764642 1764658 nd [GEA], [RSE], [BPP], [CSEUMA], [IHBCE] [7], [14], [23], [24], [25], [26], [27]
  OxyR activator sufAp Sigma70 -210.0 -242.0 sufA, sufB, sufC, sufD, sufS, sufE
ctatctcttaAATAGTCATTTTCAATAcaactttttc
1764620 1764636 nd [GEA], [BPP], [SM] [14], [23], [24], [25], [26], [27]
  OxyR activator trxCp Sigma70 -57.0 -117.0 trxC
ccaaagcctgCGACTATCATACCTATTgaataaaaca
2718610 2718626 nd [GEA], [RSE], [APIORCISFBSCS], [BPP], [CEEUMA], [IHBCE] [7], [28]
  OxyR activator trxCp Sigma70 -35.0 -95.0 trxC
ctattgaataAAACAGATTGTTGTCTGgaacaatgtc
2718632 2718648 nd [GEA], [APIORCISFBSCS], [BPP] [28]
  OxyR activator uofp nd -62.0 -166.0 uof, fur
acgccgtattAATAGATAATGCCAATCaaaataattg
710883 710899 nd [GEA], [RSE], [APIORCISFBSCS], [BPP], [CEEUMA], [IHBCE] [7], [29]
  OxyR activator uofp nd -40.0 -144.0 uof, fur
caatcaaaatAATTGCTACAAATTTGTaacttttgct
710861 710877 nd [GEA], [APIORCISFBSCS], [BPP] [29]
  OxyR repressor uxuAp Sigma70 -54.0 -172.0 uxuA, uxuB
aaattcttgtGATGTGGTTAACCAATTtcagaattcg
4551456 4551472 nd [GEA], [APIORCISFBSCS] [14]
  OxyR repressor uxuAp Sigma70 -32.0 -150.0 uxuA, uxuB
caatttcagaATTCGGGTTGACATGTCttaccaaaag
4551478 4551494 nd [GEA], [APIORCISFBSCS] [14]
  OxyR repressor ybjCp Sigma70 -72.0 -93.0 ybjC, nfsA, rimK, ybjN
attcgctgaaAGTAGGTTTAACCTGTTgcattaattg
890812 890828 nd [GEA], [APIORCISFBSCS], [BPP] [14], [16]
  OxyR repressor ybjCp Sigma70 -50.0 -71.0 ybjC, nfsA, rimK, ybjN
ctgttgcattAATTGCTAAAAGCTATAactgttaaac
890834 890850 nd [GEA], [RSE], [APIORCISFBSCS], [BPP], [CEEUMA], [IHBCE] [7], [14], [16]
  OxyR repressor ychFp Sigma70 9.5 -61.5 ychF
aataggcaaaGTTATTTCCATTTCTGCaatctgttag
1257865 1257881 nd [APIORCISFBSCS], [BPP] [30]
  OxyR repressor ychFp Sigma70 31.5 -39.5 ychF
tctgcaatctGTTAGCAATAACAGGTTgattattaag
1257843 1257859 nd [APIORCISFBSCS], [BPP] [30]
  OxyR activator yhjAp Sigma70 -86.0 -159.0 ccp
tgatctgggtAATAGGCACAGGCTATCttattgatag
3669339 3669355 nd [RSE], [AIBSCS], [BPP], [CEEUMA], [IHBCE] [7], [31]
  OxyR activator yhjAp Sigma70 -64.0 -137.0 ccp
ctatcttattGATAGTTTATATTCATGtaattgattg
3669317 3669333 nd [APIORCISFBSCS], [BPP] [31]
  OxyR activator yjjZp Sigma70 -62.0 -89.0 yjjZ
taatcatagcGATAGGTTTACCCGATAgcaagggatt
4605707 4605723 nd [APIORCISFBSCS], [BPP], [GEA], [RSE], [CEEUMA], [IHBCE] [5], [7]
  OxyR activator zinTp Sigma70 21.5 -8.5 zinT
tatacattaaCTCTGGAGGAAACTGTTttggcgattc
2041358 2041374 nd [RSE], [CEEUMA], [IHBCE] [7]
  OxyR activator znuAp Sigma38 55.5 -23.5 znuA
atatcacactTCTCATATTCATTACGAttattggtcg
1942598 1942614 nd [CEEUMA], [IHBCE], [RSE], [CEEUMA], [IHBCE] [7]
  OxyR activator znuCp Sigma70 -27.5 -55.5 znuC, znuB
cgaccaataaTCGTAATGAATATGAGAagtgtgatat
1942598 1942614 nd [RSE], [CEEUMA], [IHBCE] [7]



High-throughput Transcription factor binding sites (TFBSs)
      

  Functional conformation Function Object name Object type Distance to first Gene Sequence LeftPos RightPos Center Position Growth Condition Evidence (Confirmed, Strong, Weak) References
  OxyR activator ahpC gene -324.5
agtcgagtaaAAGGCATAACCTATCACTGTcataggtaag
638611 638630 638620.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [7]
  OxyR activator ahpC gene -309.5
ataacctatcACTGTCATAGGTAAGAGCTTagatcaggtg
638626 638645 638635.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [7]
  OxyR activator ahpC gene -302.5
atcactgtcaTAGGTAAGAGCTTAGATCAGgtgattgccc
638633 638652 638642.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [7]
  OxyR activator ahpC gene -86.5
cgaaggttgtAAGGTAAAACTTATCGATTTgataatggaa
638849 638868 638858.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [7]
  OxyR activator ahpF gene 50.5
aggcttacctTGAGAAATTGACCAAGCCTGttgagttaat
639794 639813 639803.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [7]
  OxyR activator dps gene -86.5
ttccgctattCTGGCTGTTCCTATCACACTaatagtggta
848988 849007 848997.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [7]
  OxyR activator dps gene -101.5
tgttcctatcACACTAATAGTGGTAACAAGcgtgaaaaac
849003 849022 849012.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [7]
  OxyR activator dps gene -143.5
aactaataaaGATTCAATGAGTTAGATATAttgataagaa
849045 849064 849054.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [7]
  OxyR activator dps gene -150.5
aaagattcaaTGAGTTAGATATATTGATAAgaacaattct
849052 849071 849061.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [7]
  OxyR activator grxA gene 0.5
accaaaaataACGGTTTGCATTATTTCTCTcctcatagat
890743 890762 890752.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [7]
  OxyR repressor ybjC gene -160.5
accaaaaataACGGTTTGCATTATTTCTCTcctcatagat
890743 890762 890752.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [7]
  OxyR activator grxA gene -70.5
tcgctgaaagTAGGTTTAACCTGTTGCATTaattgctaaa
890814 890833 890823.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [7]
  OxyR repressor ybjC gene -89.5
tcgctgaaagTAGGTTTAACCTGTTGCATTaattgctaaa
890814 890833 890823.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [7]
  OxyR activator grxA gene -85.5
ttaacctgttGCATTAATTGCTAAAAGCTAtaactgttaa
890829 890848 890838.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [7]
  OxyR repressor ybjC gene -74.5
ttaacctgttGCATTAATTGCTAAAAGCTAtaactgttaa
890829 890848 890838.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [7]
  OxyR activator grxA gene -92.5
gttgcattaaTTGCTAAAAGCTATAACTGTtaaacacaat
890836 890855 890845.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [7]
  OxyR repressor ybjC gene -67.5
gttgcattaaTTGCTAAAAGCTATAACTGTtaaacacaat
890836 890855 890845.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [7]
  OxyR activator grxA gene -98.5
ttaattgctaAAAGCTATAACTGTTAAACAcaatacagtg
890842 890861 890851.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [APIORCISFBSCS], [CEEUMA], [RSE] [7]
  OxyR repressor ybjC gene -61.5
ttaattgctaAAAGCTATAACTGTTAAACAcaatacagtg
890842 890861 890851.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [APIORCISFBSCS], [CEEUMA], [RSE] [7]
  OxyR activator grxA gene -101.5
attgctaaaaGCTATAACTGTTAAACACAAtacagtgaaa
890845 890864 890854.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [7]
  OxyR repressor ybjC gene -58.5
attgctaaaaGCTATAACTGTTAAACACAAtacagtgaaa
890845 890864 890854.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [7]
  OxyR repressor mdtK gene 84.5
aatcgcccaaACTGCGATGGGTTTTGTCGAtaccgtgatg
1743532 1743551 1743541.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [7]
  OxyR activator sufB gene 24.5
ggtccaggttTTGACATCGTCAGTTGCTTCagtattacga
1763975 1763994 1763984.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [7]
  OxyR activator sufA gene -51.5
taacagcatgTTAGTGATAATGATTATCAGttcaacccag
1764428 1764447 1764437.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [7]
  OxyR repressor flu gene -230.5
gtgcaatagcTCAATAATAGAATAAAACGAtcaatatcta
2071299 2071318 2071308.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [7]
  OxyR repressor flu gene -223.5
agctcaataaTAGAATAAAACGATCAATATctattttatc
2071306 2071325 2071315.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [7]
  OxyR repressor flu gene -204.5
acgatcaataTCTATTTTATCGATCGTTTAtatcgatcga
2071325 2071344 2071334.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [7]
  OxyR repressor flu gene -198.5
aatatctattTTATCGATCGTTTATATCGAtcgataagct
2071331 2071350 2071340.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [7]
  OxyR repressor flu gene -191.5
attttatcgaTCGTTTATATCGATCGATAAgctaataata
2071338 2071357 2071347.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [7]
  OxyR activator mntH gene 90.5
gttaccgggaTCGATATAACCAATCGCCGCaatgaacgca
2512606 2512625 2512615.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [7]
  OxyR activator mntH gene -85.5
ttcatttaaaTGGATTGTGGTGATTTCTCTgatagaccag
2512782 2512801 2512791.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [7]
  OxyR activator mntH gene -107.5
atttctctgaTAGACCAGGATTATGACTACgaaaagattg
2512804 2512823 2512813.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [7]
  OxyR activator trxC gene -122.5
tttcgtaccaAAGCCTGCGACTATCATACCtattgaataa
2718603 2718622 2718612.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [7]
  OxyR activator trxC gene -113.5
aaagcctgcgACTATCATACCTATTGAATAaaacagattg
2718612 2718631 2718621.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [7]
  OxyR repressor ribB gene -324.5
ttctggtttaTGACTTACCCTTATCGCACTacaatggcac
3184781 3184800 3184790.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [7]
  OxyR repressor yidD gene -336.5
tgaccgtttcTAAGTAATAAAGCTAACCCCtgagtggtta
3884470 3884489 3884479.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [7]
  OxyR activator metE gene -237.5
caggtgttttACTTCGATCATGAAAGTCCTtcacttcggc
4012806 4012825 4012815.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [7]
  OxyR activator metR gene 0.5
caggtgttttACTTCGATCATGAAAGTCCTtcacttcggc
4012806 4012825 4012815.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [7]
  OxyR activator oxyR gene -63.5
tcagtcagaaTGCTTGATAGGGATAATCGTtcattgctat
4158417 4158436 4158426.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [7]
  OxyR activator oxyR gene -54.5
atgcttgataGGGATAATCGTTCATTGCTAttctacctat
4158426 4158445 4158435.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [7]
  OxyR activator oxyR gene -25.5
attctacctaTCGCCATGAACTATCGTGGCgatggaggat
4158455 4158474 4158464.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [7]
  OxyR repressor rdcA gene -75.5
attatttcttGCAGTAATTATAAAAGCCGAaaacagaact
4327050 4327069 4327059.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [7]
  OxyR repressor fimB gene -269.5
acatgatataTAGATAAGATTAGTTGCATTaatgatgagg
4540678 4540697 4540687.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [7]
  OxyR activator yjjZ gene -370.5
tcatcggttgGTTGCGATAGATATGATCGGaatagaccgc
4605424 4605443 4605433.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [7]
  OxyR activator yjjZ gene -92.5
attgctaatcATAGCGATAGGTTTACCCGAtagcaaggga
4605702 4605721 4605711.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [7]
  OxyR activator yjjZ gene -29.5
aaattatcatATGATATTGGTTATCATTATcaatgaaaga
4605765 4605784 4605774.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [7]
  OxyR activator yjjZ gene -23.5
tcatatgataTTGGTTATCATTATCAATGAaagagatgaa
4605771 4605790 4605780.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [7]
  OxyR activator yjjZ gene -8.5
tatcattatcAATGAAAGAGATGAAATCATgttgcaacgt
4605786 4605805 4605795.5 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [7]
  OxyR activator xthA Gene nd
nd
nd nd nd nd [GEA], [BPP] [32]
Other High-throughput regulatory interactions with weak evidence


Growth Condition    

 [1] 

C: Escherichia coli str. K-12 substr. MG1655| wild type| M9 minimal medium| paraquat 0.25 mM; glucose 0.2%| mid exponential phase
E: Escherichia coli str. K-12 substr. MG1655| oxyR knockout mutant| M9 minimal medium| paraquat 0.25 mM; glucose 0.2%| mid exponential phase



Alignment and PSSM for OxyR TFBSs    

Aligned TFBS of OxyR   
  Sequence
  AAAGGCATAACCTATCACTG
  ATCGGGTAAACCTATCGCTA
  GTAGGTTTAACCTGTTGCAT
  ATTGCTAAAAGCTATAACTG
  ATTGGCATTATCTATTAATA
  ATTGGTTATCATTATCAATG
  TAAGCTCTTACCTATGACAG
  TAAGGTAAAACTTATCGATT
  TAAGATCTCAACTATCGCAT
  ATCGATATAAACGATCGATA
  ATCGCCATGAACTATCGTGG
  ATAGAATAAAACGATCAATA
  ATGAATATAAACTATCAATA
  ATAGCCTGTGCCTATTACCC
  TCTGATTTGACCTCTCACAG
  TCTGGCTGTTCCTATCACAC
  ATTGAAAATGACTATTTAAG
  ATGTGGTTAACCAATTTCAG
  ATAGCAATGAACGATTATCC
  GCTTGTTACCACTATTAGTG
  ATTAGCAATCATTATCATTT
  ATAGACCAGGATTATGACTA
  ATGCGTTTCCATTATCAAAT
  TTCGGCATGAATAATTTGCG
  CACTTTTTTACCTATCTCTT
  GACTATCATACCTATTGAAT
  CATGATTTCATCTCTTTCAT
  ATGGATTGTGGTGATTTCTC
  TTCGGGTTGACATGTCTTAC
  GTGGATTAATTCAATTATAA
  TTAGCAATAACAGGTTGATT
  CAGGCATAAATCTATGAGGA
  TCTGGAGGAAACTGTTTTGG
  GGAAGAAGAACTAATTGCTG
  AATCGTAATGAATATGAGAA
  TGAGGAATATACAGTAACCG
  GTTCCAGACAACAATCTGTT
  CAAAGTTATTTCCATTTCTG
  TAACGGTAACACTGTAGAGG
  CAAATTTGTAGCAATTATTT
  TATAGCACCGGCTATGTGTT
  TCTTGTCCGTGCAATAGCTC

Position weight matrix (PWM). OxyR matrix-quality result   
A	18	13	15	6	11	9	16	16	16	26	18	3	8	34	0	4	20	11	13	9
C	5	5	7	4	8	9	5	2	6	5	14	31	1	2	0	16	0	18	4	6
G	6	2	6	27	21	4	2	6	7	6	5	0	5	6	0	5	11	6	4	15
T	13	22	14	5	2	20	19	18	13	5	5	8	28	0	42	17	11	7	21	12

Consensus   
;	consensus.strict             	ataGgtttaacCtATcactg
;	consensus.strict.rc          	CAGTGATAGGTTAAACCTAT
;	consensus.IUPAC              	wwwGgywwwamCtATyrcwg
;	consensus.IUPAC.rc           	CWGYRATAGKTWWWRCCWWW
;	consensus.regexp             	[at][at][at]Gg[ct][at][at][at]a[ac]CtAT[ct][ag]c[at]g
;	consensus.regexp.rc          	C[AT]G[CT][AG]ATAG[GT]T[AT][AT][AT][AG]CC[AT][AT][AT]

PWM logo   


 


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation




Reference(s)    

 [1] Campos E., Montella C., Garces F., Baldoma L., Aguilar J., Badia J., 2007, Aerobic L-ascorbate metabolism and associated oxidative stress in Escherichia coli., Microbiology 153(Pt 10):3399-408

 [2] Tartaglia LA., Gimeno CJ., Storz G., Ames BN., 1992, Multidegenerate DNA recognition by the OxyR transcriptional regulator., J Biol Chem 267(3):2038-45

 [3] Tartaglia LA., Storz G., Ames BN., 1989, Identification and molecular analysis of oxyR-regulated promoters important for the bacterial adaptation to oxidative stress., J Mol Biol 210(4):709-19

 [4] Toledano MB., Kullik I., Trinh F., Baird PT., Schneider TD., Storz G., 1994, Redox-dependent shift of OxyR-DNA contacts along an extended DNA-binding site: a mechanism for differential promoter selection., Cell 78(5):897-909

 [5] Zheng M., Wang X., Doan B., Lewis KA., Schneider TD., Storz G., 2001, Computation-directed identification of OxyR DNA binding sites in Escherichia coli., J Bacteriol 183(15):4571-9

 [6] Storz G., Tartaglia LA., Ames BN., 1990, Transcriptional regulator of oxidative stress-inducible genes: direct activation by oxidation., Science 248(4952):189-94

 [7] Seo SW., Kim D., Szubin R., Palsson BO., 2015, Genome-wide Reconstruction of OxyR and SoxRS Transcriptional Regulatory Networks under Oxidative Stress in Escherichia coli K-12 MG1655., Cell Rep 12(8):1289-99

 [8] Guo Y., Li Y., Zhan W., Wood TK., Wang X., 2019, Resistance to oxidative stress by inner membrane protein ElaB is regulated by OxyR and RpoS., Microb Biotechnol 12(2):392-404

 [9] Haagmans W., van der Woude M., 2000, Phase variation of Ag43 in Escherichia coli: Dam-dependent methylation abrogates OxyR binding and OxyR-mediated repression of transcription., Mol Microbiol 35(4):877-87

 [10] Henderson IR., Owen P., 1999, The major phase-variable outer membrane protein of Escherichia coli structurally resembles the immunoglobulin A1 protease class of exported protein and is regulated by a novel mechanism involving Dam and oxyR., J Bacteriol 181(7):2132-41

 [11] Waldron DE., Owen P., Dorman CJ., 2002, Competitive interaction of the OxyR DNA-binding protein and the Dam methylase at the antigen 43 gene regulatory region in Escherichia coli., Mol Microbiol 44(2):509-20

 [12] Wallecha A., Correnti J., Munster V., van der Woude M., 2003, Phase variation of Ag43 is independent of the oxidation state of OxyR., J Bacteriol 185(7):2203-9

 [13] Wallecha A., Munster V., Correnti J., Chan T., van der Woude M., 2002, Dam- and OxyR-dependent phase variation of agn43: essential elements and evidence for a new role of DNA methylation., J Bacteriol 184(12):3338-47

 [14] Zheng M., Wang X., Templeton LJ., Smulski DR., LaRossa RA., Storz G., 2001, DNA microarray-mediated transcriptional profiling of the Escherichia coli response to hydrogen peroxide., J Bacteriol 183(15):4562-70

 [15] Becker-Hapak M., Eisenstark A., 1995, Role of rpoS in the regulation of glutathione oxidoreductase (gor) in Escherichia coli., FEMS Microbiol Lett 134(1):39-44

 [16] Tao K., 1997, oxyR-dependent induction of Escherichia coli grx gene expression by peroxide stress., J Bacteriol 179(18):5967-70

 [17] Seth D., Hausladen A., Wang YJ., Stamler JS., 2012, Endogenous protein S-Nitrosylation in E. coli: regulation by OxyR., Science 336(6080):470-3

 [18] Mancini S., Imlay JA., 2015, The induction of two biosynthetic enzymes helps Escherichia coli sustain heme synthesis and activate catalase during hydrogen peroxide stress., Mol Microbiol 96(4):744-63

 [19] Anjem A., Varghese S., Imlay JA., 2009, Manganese import is a key element of the OxyR response to hydrogen peroxide in Escherichia coli., Mol Microbiol 72(4):844-58

 [20] Kehres DG., Janakiraman A., Slauch JM., Maguire ME., 2002, Regulation of Salmonella enterica serovar Typhimurium mntH transcription by H(2)O(2), Fe(2+), and Mn(2+)., J Bacteriol 184(12):3151-8

 [21] Christman MF., Storz G., Ames BN., 1989, OxyR, a positive regulator of hydrogen peroxide-inducible genes in Escherichia coli and Salmonella typhimurium, is homologous to a family of bacterial regulatory proteins., Proc Natl Acad Sci U S A 86(10):3484-8

 [22] Kullik I., Toledano MB., Tartaglia LA., Storz G., 1995, Mutational analysis of the redox-sensitive transcriptional regulator OxyR: regions important for oxidation and transcriptional activation., J Bacteriol 177(5):1275-84

 [23] Engl C., Jovanovic G., Brackston RD., Kotta-Loizou I., Buck M., 2020, The route to transcription initiation determines the mode of transcriptional bursting in E. coli., Nat Commun 11(1):2422

 [24] Jang S., Imlay JA., 2010, Hydrogen peroxide inactivates the Escherichia coli Isc iron-sulphur assembly system, and OxyR induces the Suf system to compensate., Mol Microbiol 78(6):1448-67

 [25] Lee JH., Yeo WS., Roe JH., 2004, Induction of the sufA operon encoding Fe-S assembly proteins by superoxide generators and hydrogen peroxide: involvement of OxyR, IHF and an unidentified oxidant-responsive factor., Mol Microbiol 51(6):1745-55

 [26] Outten FW., Djaman O., Storz G., 2004, A suf operon requirement for Fe-S cluster assembly during iron starvation in Escherichia coli., Mol Microbiol 52(3):861-72

 [27] Yeo WS., Lee JH., Lee KC., Roe JH., 2006, IscR acts as an activator in response to oxidative stress for the suf operon encoding Fe-S assembly proteins., Mol Microbiol 61(1):206-18

 [28] Ritz D., Patel H., Doan B., Zheng M., Aslund F., Storz G., Beckwith J., 2000, Thioredoxin 2 is involved in the oxidative stress response in Escherichia coli., J Biol Chem 275(4):2505-12

 [29] Zheng M., Doan B., Schneider TD., Storz G., 1999, OxyR and SoxRS regulation of fur., J Bacteriol 181(15):4639-43

 [30] Wenk M., Ba Q., Erichsen V., Macinnes K., Wiese H., Warscheid B., Koch HG., 2012, A Universally Conserved ATPase Regulates the Oxidative Stress Response in Escherichia coli., J Biol Chem 287(52):43585-98

 [31] Partridge JD., Poole RK., Green J., 2007, The Escherichia coli yhjA gene, encoding a predicted cytochrome c peroxidase, is regulated by FNR and OxyR., Microbiology 153(Pt 5):1499-509

 [32] Gupta A., Imlay JA., 2021, Escherichia coli induces DNA repair enzymes to protect itself from low-grade hydrogen peroxide stress., Mol Microbiol

 [33] Storz G, Tartaglia LA, Ames BN, 1990, The OxyR regulon., Antonie Van Leeuwenhoek, 58(3):157 10.1007/BF00548927

 [34] Mongkolsuk S, Helmann JD, 2002, Regulation of inducible peroxide stress responses., Mol Microbiol, 45(1):9 10.1046/j.1365-2958.2002.03015.x

 [35] Altuvia S., Weinstein-Fischer D., Zhang A., Postow L., Storz G., 1997, A small, stable RNA induced by oxidative stress: role as a pleiotropic regulator and antimutator., Cell 90(1):43-53

 [36] Tao K., Makino K., Yonei S., Nakata A., Shinagawa H., 1991, Purification and characterization of the Escherichia coli OxyR protein, the positive regulator for a hydrogen peroxide-inducible regulon., J Biochem 109(2):262-6

 [37] Anand A, Chen K, Catoiu E, Sastry AV, Olson CA, Sandberg TE, Seif Y, Xu S, Szubin R, Yang L, Feist AM, Palsson BO, 2020, OxyR Is a Convergent Target for Mutations Acquired during Adaptation to Oxidative Stress-Prone Metabolic States., Mol Biol Evol, 37(3):660 10.1093/molbev/msz251

 [38] Sastry AV, Gao Y, Szubin R, Hefner Y, Xu S, Kim D, Choudhary KS, Yang L, King ZA, Palsson BO, 2019, The Escherichia coli transcriptome mostly consists of independently regulated modules., Nat Commun, 10(1):5536 10.1038/s41467-019-13483-w

 [39] Gonzalez-Flecha B., Demple B., 1997, Transcriptional regulation of the Escherichia coli oxyR gene as a function of cell growth., J Bacteriol 179(19):6181-6

 [40] Tao K., Makino K., Yonei S., Nakata A., Shinagawa H., 1989, Molecular cloning and nucleotide sequencing of oxyR, the positive regulatory gene of a regulon for an adaptive response to oxidative stress in Escherichia coli: homologies between OxyR protein and a family of bacterial activator proteins., Mol Gen Genet 218(3):371-6

 [41] Kullik I, Stevens J, Toledano MB, Storz G, 1995, Mutational analysis of the redox-sensitive transcriptional regulator OxyR: regions important for DNA binding and multimerization., J Bacteriol, 177(5):1285 10.1128/jb.177.5.1285-1291.1995

 [42] Lee C, Lee SM, Mukhopadhyay P, Kim SJ, Lee SC, Ahn WS, Yu MH, Storz G, Ryu SE, 2004, Redox regulation of OxyR requires specific disulfide bond formation involving a rapid kinetic reaction path., Nat Struct Mol Biol, 11(12):1179 10.1038/nsmb856

 [43] Zaim J, Kierzek AM, 2003, The structure of full-length LysR-type transcriptional regulators. Modeling of the full-length OxyR transcription factor dimer., Nucleic Acids Res, 31(5):1444 10.1093/nar/gkg234

 [44] Li X, Imlay JA, 2018, Improved measurements of scant hydrogen peroxide enable experiments that define its threshold of toxicity for Escherichia coli., Free Radic Biol Med, 120(None):217 10.1016/j.freeradbiomed.2018.03.025

 [45] Zheng M, Aslund F, Storz G, 1998, Activation of the OxyR transcription factor by reversible disulfide bond formation., Science, 279(5357):1718 10.1126/science.279.5357.1718

 [46] Aslund F, Zheng M, Beckwith J, Storz G, 1999, Regulation of the OxyR transcription factor by hydrogen peroxide and the cellular thiol-disulfide status., Proc Natl Acad Sci U S A, 96(11):6161 10.1073/pnas.96.11.6161

 [47] Hausladen A, Privalle CT, Keng T, DeAngelo J, Stamler JS, 1996, Nitrosative stress: activation of the transcription factor OxyR., Cell, 86(5):719 10.1016/s0092-8674(00)80147-6

 [48] Barraud N, Létoffé S, Beloin C, Vinh J, Chiappetta G, Ghigo JM, 2021, Lifestyle-specific S-nitrosylation of protein cysteine thiols regulates Escherichia coli biofilm formation and resistance to oxidative stress., NPJ Biofilms Microbiomes, 7(1):34 10.1038/s41522-021-00203-w

 [49] Choi H, Kim S, Mukhopadhyay P, Cho S, Woo J, Storz G, Ryu SE, 2001, Structural basis of the redox switch in the OxyR transcription factor., Cell, 105(1):103 10.1016/s0092-8674(01)00300-2

 [50] Hou N, Yan Z, Fan K, Li H, Zhao R, Xia Y, Xun L, Liu H, 2019, OxyR senses sulfane sulfur and activates the genes for its removal in Escherichia coli., Redox Biol, 26(None):101293 10.1016/j.redox.2019.101293

 [51] Deter HS, Hossain T, Butzin NC, 2021, Antibiotic tolerance is associated with a broad and complex transcriptional response in E. coli., Sci Rep, 11(1):6112 10.1038/s41598-021-85509-7

 [52] Knapp GS, Hu JC, 2010, Specificity of the E. coli LysR-type transcriptional regulators., PLoS One, 5(12):e15189 10.1371/journal.pone.0015189

 [53] Muraoka S, Okumura R, Ogawa N, Nonaka T, Miyashita K, Senda T, 2003, Crystal structure of a full-length LysR-type transcriptional regulator, CbnR: unusual combination of two subunit forms and molecular bases for causing and changing DNA bend., J Mol Biol, 328(3):555 10.1016/s0022-2836(03)00312-7

 [54] Gusarov I, Nudler E, 2012, S-nitrosylation signaling in Escherichia coli., Sci Signal, 5(228):pe26 10.1126/scisignal.2003181

 [55] Tao K, Zou C, Fujita N, Ishihama A, 1995, Mapping of the OxyR protein contact site in the C-terminal region of RNA polymerase alpha subunit., J Bacteriol, 177(23):6740 10.1128/jb.177.23.6740-6744.1995

 [56] Seth D, Hausladen A, Stamler JS, 2020, Anaerobic Transcription by OxyR: A Novel Paradigm for Nitrosative Stress., Antioxid Redox Signal, 32(12):803 10.1089/ars.2019.7921

 [57] Chiang SM, Schellhorn HE, 2012, Regulators of oxidative stress response genes in Escherichia coli and their functional conservation in bacteria., Arch Biochem Biophys, 525(2):161 10.1016/j.abb.2012.02.007



RegulonDB