RegulonDB RegulonDB 11.1:Regulon Page

PhoB DNA-binding transcriptional dual regulator

Synonyms: PhoB, PhoB-phosphorylated
PhoB is a dual transcription regulator that activates expression of the Pho regulon in response to environmental Pi. The Pho regulon includes operons and genes whose products are involved in phosphorus uptake and metabolism [3, 21, 22] Expression of the periplasmic binding proteins for peptide transport, OppA and DppA, is repressed by PhoB [23] In a proteomic analysis under phosphate-limiting conditions, it was found that up to 400 proteins are differentially expressed [22] PhoB is also involved in bacterial virulence of pathogenic Escherichia coli [24] PhoB also regulates genes involved in the stimulation of cell persister resuscitation [25] PhoB is a response regulator and belongs to the two-component system PhoR/PhoB. Under phosphate-limited conditions, the inner membrane sensor kinase PhoR autophosphorylates.
Read more >

Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) References
PhoB-phosphorylated Functional Covalent Holo [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IPI] S [1]
Evolutionary Family: OmpR
TFBs length: 19
TFBs symmetry: direct-repeat
Sensing class: External-Two-component systems
Connectivity class: Local Regulator
Gene name: phoB
  Genome position: 417142-417831
  Length: 690 bp / 229 aa
Operon name: phoBR
TU(s) encoding the TF:
Transcription unit        Promoter

Regulated gene(s) adiC, amn, argP, asr, cra, cusA, cusB, cusC, cusF, cusR, cusS, eda, feaR, gadW, gadX, hiuH, mipA, ompF, phnC, phnD, phnE, phnF, phnG, phnH, phnI, phnJ, phnK, phnL, phnM, phnN, phnO, phnP, phoA, phoB, phoE, phoH, phoQ, phoR, phoU, pitB, prpR, psiE, psiF, pstA, pstB, pstC, pstS, rcdB, rspR, sbcC, sbcD, tktB, ugpA, ugpB, ugpC, ugpE, ugpQ, waaH, yegH, ytfK
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
phosphorous metabolism (24)
membrane (12)
Transcription related (11)
activator (7)
repressor (6)
Read more >
Regulated operon(s) adiC, amn, argP, asr, cra, cusCFBA, cusRS, edd-eda, feaR, gadAXW, hiuH, mipA, ompF, phnCDEFGHIJKLMNOP, phoA-psiF, phoBR, phoE, phoH, phoPQ, pitB, prpR, psiE, pstSCAB-phoU, rcdB, rspR, sbcDC, talA-tktB, ugpBAECQ, waaH, yegH, ytfK
First gene in the operon(s) adiC, amn, argP, asr, cra, cusC, cusR, eda, feaR, gadX, hiuH, mipA, ompF, phnC, phoA, phoB, phoE, phoH, phoQ, phoU, pitB, prpR, psiE, pstS, sbcD, tktB, ugpB, rspR, yegH, rcdB, waaH, ytfK
Simple and complex regulons AlpA,PhoB
Read more >
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)

Transcription factor regulation    

Transcription factor binding sites (TFBSs) arrangements

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence
LeftPos RightPos Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) References
  PhoB-phosphorylated activator adiCp7 Sigma32 nd nd adiC nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS] W [2]
  PhoB-phosphorylated activator amnp1 nd -33.0 -63.0 amn
  PhoB-phosphorylated activator argPp nd -27.0 -50.0 argP
  PhoB-phosphorylated activator asrp Sigma70 -30.0 -79.0 asr
  PhoB-phosphorylated activator asrp2 Sigma38 -30.0 -79.0 asr
  PhoB-phosphorylated activator cusCp Sigma70 -54.0 -81.0 cusC, cusF, cusB, cusA
  PhoB-phosphorylated activator cusRp Sigma70 -57.0 -76.0 cusR, cusS
  PhoB-phosphorylated repressor edap3 nd -53.0 -81.0 eda
  PhoB-phosphorylated repressor feaRp2 Sigma70 -17.0 -43.0 feaR
  PhoB-phosphorylated repressor fruRp8 Sigma32 nd nd cra nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS] W [2]
  PhoB-phosphorylated activator gadXp Sigma38 nd nd gadX, gadW nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS] W [2]
  PhoB-phosphorylated activator hiuHp Sigma70 nd nd hiuH nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] S [6], [6]
  PhoB-phosphorylated activator mipAp nd -146.5 -180.5 mipA
  PhoB-phosphorylated activator ompFp Sigma70 nd nd ompF nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS] W [2]
  PhoB-phosphorylated activator ompFp2 Sigma38 nd nd ompF nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS] W [2]
  PhoB-phosphorylated activator phnCp Sigma70 nd nd phnC, phnD, phnE, phnF, phnG, phnH, phnI, phnJ, phnK, phnL, phnM, phnN, phnO, phnP nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] S [2], [8], [8], [9]
  PhoB-phosphorylated activator phoAp Sigma70 -31.0 -71.0 phoA, psiF
  PhoB-phosphorylated activator phoBp Sigma70 -31.0 -72.0 phoB, phoR
  PhoB-phosphorylated activator phoEp Sigma70 -113.0 -171.0 phoE
  PhoB-phosphorylated activator phoEp Sigma70 -88.0 -146.0 phoE
  PhoB-phosphorylated activator phoEp Sigma70 -32.0 -90.0 phoE
  PhoB-phosphorylated activator phoHp1 Sigma70 -31.0 -158.0 phoH
  PhoB-phosphorylated activator phoQp5 Sigma24 nd nd phoQ nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS] W [2]
  PhoB-phosphorylated activator phoUp Sigma70 nd nd phoU nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS] W [2]
  PhoB-phosphorylated repressor pitBp Sigma70 nd nd pitB nd nd [EXP-IMP] W [13]
  PhoB-phosphorylated repressor prpRp Sigma70 -24.0 -52.0 prpR
  PhoB-phosphorylated activator psiEp Sigma70 -53.0 -78.0 psiE
  PhoB-phosphorylated activator psiEp Sigma70 -31.0 -56.0 psiE
  PhoB-phosphorylated activator pstSp Sigma70 -54.0 -97.0 pstS, pstC, pstA, pstB, phoU
  PhoB-phosphorylated activator pstSp Sigma70 -32.0 -75.0 pstS, pstC, pstA, pstB, phoU
  PhoB-phosphorylated activator pstSp2 Sigma38 -54.0 -97.0 pstS, pstC, pstA, pstB, phoU
  PhoB-phosphorylated activator pstSp2 Sigma38 -32.0 -75.0 pstS, pstC, pstA, pstB, phoU
  PhoB-phosphorylated repressor sbcDp Sigma70 -93.0 -118.0 sbcD, sbcC
  PhoB-phosphorylated activator tktBp Sigma38 nd nd tktB nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS] W [2]
  PhoB-phosphorylated activator ugpBp1 Sigma70 -52.0 -105.0 ugpB, ugpA, ugpE, ugpC, ugpQ
  PhoB-phosphorylated activator ugpBp1 Sigma70 -30.0 -83.0 ugpB, ugpA, ugpE, ugpC, ugpQ
  PhoB-phosphorylated repressor ugpBp2 Sigma70 -26.0 -127.0 ugpB, ugpA, ugpE, ugpC, ugpQ
  PhoB-phosphorylated repressor ugpBp2 Sigma70 -4.0 -105.0 ugpB, ugpA, ugpE, ugpC, ugpQ
  PhoB-phosphorylated activator ydfHp nd -20.0 -46.0 rspR
  PhoB-phosphorylated activator yhjCp Sigma54 nd nd rcdB nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] S [6], [6]
  PhoB-phosphorylated activator yibDp1 Sigma70 -113.0 -181.0 waaH
  PhoB-phosphorylated activator yibDp1 Sigma70 -59.5 -127.5 waaH
  PhoB-phosphorylated activator ytfKp1 Sigma38 -58.0 -134.0 ytfK
  PhoB-phosphorylated activator ytfKp1 Sigma38 -36.0 -112.0 ytfK

Alignment and PSSM for PhoB TFBSs    

Aligned TFBS of PhoB   

Position weight matrix (PWM). PhoB matrix-quality result   
A	13	5	9	4	1	15	4	22	4	8	2	3	1	12	3	3	12	6	24	7
C	3	4	3	1	2	1	20	1	3	6	3	1	1	4	4	2	2	13	1	5
G	2	4	9	2	13	4	0	1	11	0	1	3	1	9	1	14	4	4	0	11
T	8	13	5	19	10	6	2	2	8	12	20	19	23	1	18	7	8	3	1	3

;	consensus.strict             	atgtgaCAgtttTgtgacAg
;	consensus.strict.rc          	CTGTCACAAAACTGTCACAT
;	consensus.IUPAC              	wtrtkaCAkhttTrtgwcAg
;	consensus.IUPAC.rc           	CTGWCAYAAADMTGTMAYAW
;	consensus.regexp             	[at]t[ag]t[gt]aCA[gt][act]ttT[ag]tg[at]cAg
;	consensus.regexp.rc          	CTG[AT]CA[CT]AAA[AGT][AC]TGT[AC]A[CT]A[AT]

PWM logo   


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation


 [1] Yamamoto K., Hirao K., Oshima T., Aiba H., Utsumi R., Ishihama A., 2005, Functional characterization in vitro of all two-component signal transduction systems from Escherichia coli., J Biol Chem 280(2):1448-56

 [2] Marzan LW., Hasan CM., Shimizu K., 2013, Effect of acidic condition on the metabolic regulation of Escherichia coli and its phoB mutant., Arch Microbiol 195(3):161-71

 [3] Baek JH., Lee SY., 2006, Novel gene members in the Pho regulon of Escherichia coli., FEMS Microbiol Lett 264(1):104-9

 [4] Han JS., Park JY., Lee YS., Thony B., Hwang DS., 1999, PhoB-dependent transcriptional activation of the iciA gene during starvation for phosphate in Escherichia coli., Mol Gen Genet 262(3):448-52

 [5] Suziedeliene E., Suziedelis K., Garbenciute V., Normark S., 1999, The acid-inducible asr gene in Escherichia coli: transcriptional control by the phoBR operon., J Bacteriol 181(7):2084-93

 [6] Yang C., Huang TW., Wen SY., Chang CY., Tsai SF., Wu WF., Chang CH., 2012, Genome-wide PhoB binding and gene expression profiles reveal the hierarchical gene regulatory network of phosphate starvation in Escherichia coli., PLoS One 7(10):e47314

 [7] Murray EL., Conway T., 2005, Multiple regulators control expression of the Entner-Doudoroff aldolase (Eda) of Escherichia coli., J Bacteriol 187(3):991-1000

 [8] Makino K., Kim SK., Shinagawa H., Amemura M., Nakata A., 1991, Molecular analysis of the cryptic and functional phn operons for phosphonate use in Escherichia coli K-12., J Bacteriol 173(8):2665-72

 [9] Wanner BL., Boline JA., 1990, Mapping and molecular cloning of the phn (psiD) locus for phosphonate utilization in Escherichia coli., J Bacteriol 172(3):1186-96

 [10] Makino K., Shinagawa H., Amemura M., Nakata A., 1986, Nucleotide sequence of the phoB gene, the positive regulatory gene for the phosphate regulon of Escherichia coli K-12., J Mol Biol 190(1):37-44

 [11] Tommassen J., Koster M., Overduin P., 1987, Molecular analysis of the promoter region of the Escherichia coli K-12 phoE gene. Identification of an element, upstream from the promoter, required for efficient expression of phoE protein., J Mol Biol 198(4):633-41

 [12] Kim SK., Makino K., Amemura M., Shinagawa H., Nakata A., 1993, Molecular analysis of the phoH gene, belonging to the phosphate regulon in Escherichia coli., J Bacteriol 175(5):1316-24

 [13] Harris RM., Webb DC., Howitt SM., Cox GB., 2001, Characterization of PitA and PitB from Escherichia coli., J Bacteriol 183(17):5008-14

 [14] Kim SK., Kimura S., Shinagawa H., Nakata A., Lee KS., Wanner BL., Makino K., 2000, Dual transcriptional regulation of the Escherichia coli phosphate-starvation-inducible psiE gene of the phosphate regulon by PhoB and the cyclic AMP (cAMP)-cAMP receptor protein complex., J Bacteriol 182(19):5596-9

 [15] Miyake Y., Yamamoto K., 2020, Epistatic Effect of Regulators to the Adaptive Growth of Escherichia coli., Sci Rep 10(1):3661

 [16] Kimura S., Makino K., Shinagawa H., Amemura M., Nakata A., 1989, Regulation of the phosphate regulon of Escherichia coli: characterization of the promoter of the pstS gene., Mol Gen Genet 215(3):374-80

 [17] Makino K., Shinagawa H., Amemura M., Kimura S., Nakata A., Ishihama A., 1988, Regulation of the phosphate regulon of Escherichia coli. Activation of pstS transcription by PhoB protein in vitro., J Mol Biol 203(1):85-95

 [18] Otsuka J., Watanabe H., Mori KT., 1996, Evolution of transcriptional regulation system through promiscuous coupling of regulatory proteins with operons; suggestion from protein sequence similarities in Escherichia coli., J Theor Biol 178(2):183-204

 [19] Kasahara M., Makino K., Amemura M., Nakata A., Shinagawa H., 1991, Dual regulation of the ugp operon by phosphate and carbon starvation at two interspaced promoters., J Bacteriol 173(2):549-58

 [20] Yoshida Y., Sugiyama S., Oyamada T., Yokoyama K., Kim SK., Makino K., 2011, Identification of PhoB binding sites of the yibD and ytfK promoter regions in Escherichia coli., J Microbiol 49(2):285-9

 [21] Wanner BL, 1993, Gene regulation by phosphate in enteric bacteria., J Cell Biochem, 51(1):47 10.1002/jcb.240510110

 [22] VanBogelen RA, Olson ER, Wanner BL, Neidhardt FC, 1996, Global analysis of proteins synthesized during phosphorus restriction in Escherichia coli., J Bacteriol, 178(15):4344 10.1128/jb.178.15.4344-4366.1996

 [23] Smith MW, Payne JW, 1992, Expression of periplasmic binding proteins for peptide transport is subject to negative regulation by phosphate limitation in Escherichia coli., FEMS Microbiol Lett, 100(1-3):183 10.1111/j.1574-6968.1992.tb14038.x

 [24] Crépin S, Chekabab SM, Le Bihan G, Bertrand N, Dozois CM, Harel J, 2011, The Pho regulon and the pathogenesis of Escherichia coli., Vet Microbiol, 153(1-2):82 10.1016/j.vetmic.2011.05.043

 [25] Song S., Kim JS., Yamasaki R., Oh S., Benedik MJ., Wood TK., 2021, Escherichia coli cryptic prophages sense nutrients to influence persister cell resuscitation., Environ Microbiol 23(11):7245-7254

 [26] Makino K, Shinagawa H, Amemura M, Kawamoto T, Yamada M, Nakata A, 1989, Signal transduction in the phosphate regulon of Escherichia coli involves phosphotransfer between PhoR and PhoB proteins., J Mol Biol, 210(3):551 10.1016/0022-2836(89)90131-9

 [27] Gao R, Stock AM, 2013, Evolutionary tuning of protein expression levels of a positively autoregulated two-component system., PLoS Genet, 9(10):e1003927 10.1371/journal.pgen.1003927

 [28] Wanner BL, 1996, Signal transduction in the control of phosphate-regulated genes of Escherichia coli., Kidney Int, 49(4):964 10.1038/ki.1996.136

 [29] Wanner BL, Wilmes-Riesenberg MR, 1992, Involvement of phosphotransacetylase, acetate kinase, and acetyl phosphate synthesis in control of the phosphate regulon in Escherichia coli., J Bacteriol, 174(7):2124 10.1128/jb.174.7.2124-2130.1992

 [30] Amemura M, Makino K, Shinagawa H, Nakata A, 1990, Cross talk to the phosphate regulon of Escherichia coli by PhoM protein: PhoM is a histidine protein kinase and catalyzes phosphorylation of PhoB and PhoM-open reading frame 2., J Bacteriol, 172(11):6300 10.1128/jb.172.11.6300-6307.1990

 [31] Creager-Allen RL, Silversmith RE, Bourret RB, 2013, A link between dimerization and autophosphorylation of the response regulator PhoB., J Biol Chem, 288(30):21755 10.1074/jbc.M113.471763

 [32] Makino K, Amemura M, Kawamoto T, Kimura S, Shinagawa H, Nakata A, Suzuki M, 1996, DNA binding of PhoB and its interaction with RNA polymerase., J Mol Biol, 259(1):15 10.1006/jmbi.1996.0298

 [33] Makino K, Amemura M, Kim SK, Nakata A, Shinagawa H, 1993, Role of the sigma 70 subunit of RNA polymerase in transcriptional activation by activator protein PhoB in Escherichia coli., Genes Dev, 7(1):149 10.1101/gad.7.1.149

 [34] Martínez-Hackert E, Stock AM, 1997, Structural relationships in the OmpR family of winged-helix transcription factors., J Mol Biol, 269(3):301 10.1006/jmbi.1997.1065

 [35] Ellison DW, McCleary WR, 2000, The unphosphorylated receiver domain of PhoB silences the activity of its output domain., J Bacteriol, 182(23):6592 10.1128/JB.182.23.6592-6597.2000

 [36] Solá M, Gomis-Rüth FX, Serrano L, González A, Coll M, 1999, Three-dimensional crystal structure of the transcription factor PhoB receiver domain., J Mol Biol, 285(2):675 10.1006/jmbi.1998.2326

 [37] Arribas-Bosacoma R, Kim SK, Ferrer-Orta C, Blanco AG, Pereira PJ, Gomis-Rüth FX, Wanner BL, Coll M, Solà M, 2007, The X-ray crystal structures of two constitutively active mutants of the Escherichia coli PhoB receiver domain give insights into activation., J Mol Biol, 366(2):626 10.1016/j.jmb.2006.11.038

 [38] Martínez-Hackert E, Stock AM, 1997, The DNA-binding domain of OmpR: crystal structures of a winged helix transcription factor., Structure, 5(1):109 10.1016/s0969-2126(97)00170-6

 [39] Tung CS, McMahon BH, 2012, A structural model of the E. coli PhoB dimer in the transcription initiation complex., BMC Struct Biol, 12(None):3 10.1186/1472-6807-12-3

 [40] Gao R, Stock AM, 2015, Temporal hierarchy of gene expression mediated by transcription factor binding affinity and activation dynamics., mBio, 6(3):e00686 10.1128/mBio.00686-15

 [41] Blanco AG, Sola M, Gomis-Rüth FX, Coll M, 2002, Tandem DNA recognition by PhoB, a two-component signal transduction transcriptional activator., Structure, 10(5):701 10.1016/s0969-2126(02)00761-x

 [42] Bachhawat P, Swapna GV, Montelione GT, Stock AM, 2005, Mechanism of activation for transcription factor PhoB suggested by different modes of dimerization in the inactive and active states., Structure, 13(9):1353 10.1016/j.str.2005.06.006

 [43] Baek JH, Lee SY, 2007, Transcriptome analysis of phosphate starvation response in Escherichia coli., J Microbiol Biotechnol, 17(2):244 None

 [44] Grillo-Puertas M, Rintoul MR, Rapisarda VA, 2016, PhoB activation in non-limiting phosphate condition by the maintenance of high polyphosphate levels in the stationary phase inhibits biofilm formation in Escherichia coli., Microbiology (Reading), 162(6):1000 10.1099/mic.0.000281

 [45] Gao R, Stock AM, 2017, Quantitative Kinetic Analyses of Shutting Off a Two-Component System., mBio, 8(3):None 10.1128/mBio.00412-17

 [46] Gao R, Godfrey KA, Sufian MA, Stock AM, 2017, Counterbalancing Regulation in Response Memory of a Positively Autoregulated Two-Component System., J Bacteriol, 199(18):None 10.1128/JB.00390-17

 [47] Kou X, Liu X, Liu Y, Li C, Liu M, Jiang L, 2018, Backbone resonance assignment of the response regulator protein PhoBNF20D from Escherichia coli., Biomol NMR Assign, 12(1):133 10.1007/s12104-017-9795-y

 [48] Kou X, Liu Y, Li C, Liu M, Jiang L, 2018, Dimerization and Conformational Exchanges of the Receiver Domain of Response Regulator PhoB from Escherichia coli., J Phys Chem B, 122(22):5749 10.1021/acs.jpcb.8b01034

 [49] Pandi K., Chauhan AS., Khan WH., Rathore AS., 2020, Phosphate starvation controls lactose metabolism to produce recombinant protein in Escherichia coli., Appl Microbiol Biotechnol 104(22):9707-9718
