RegulonDB RegulonDB 10.9:Regulon Page

PhoB DNA-binding transcriptional dual regulator

Synonyms: PhoB-Phosphorylated, PhoB
PhoB is a dual transcription regulator that activates expression of the Pho regulon in response to environmental Pi. The Pho regulon includes operons and genes whose products are involved in phosphorus uptake and metabolism [3] Expression of the periplasmic binding proteins for peptide transport, OppA and DppA, is repressed by PhoB [] In a proteomic analysis under phosphate-limiting conditions, it was found that up to 400 proteins are differentially expressed [] PhoB is also involved in bacterial virulence of pathogenic Escherichia coli [] PhoB is a response regulator and belongs to the two-component system PhoR/PhoB. Under phosphate-limited conditions, the inner membrane sensor kinase PhoR autophosphorylates. Subsequent transfer of the phosphate group to PhoB results in activation of PhoB [] When phosphate is in excess, autophosphorylation of PhoR is inhibited and PhoB-P is dephosphorylated.
Read more >

Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
PhoB Non-Functional   Apo [BPP], [IPI] [1]
PhoB-Phosphorylated Functional Covalent Holo [BPP], [IPI] [1]
Evolutionary Family: OmpR
Sensing class: External-Two-component systems
Connectivity class: Local Regulator
Gene name: phoB
  Genome position: 417142-417831
  Length: 690 bp / 229 aa
Operon name: phoBR
TU(s) encoding the TF:
Transcription unit        Promoter

Regulated gene(s) adiC, amn, argP, asr, cra, cusA, cusB, cusC, cusF, cusR, cusS, eda, feaR, gadW, gadX, hiuH, mipA, ompF, phnC, phnD, phnE, phnF, phnG, phnH, phnI, phnJ, phnK, phnL, phnM, phnN, phnO, phnP, phoA, phoB, phoE, phoH, phoQ, phoR, phoU, pitB, prpR, psiE, psiF, pstA, pstB, pstC, pstS, rcdB, sbcC, sbcD, tktB, ugpA, ugpB, ugpC, ugpE, ugpQ, waaH, ydfH, yegH, ytfK
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
phosphorous metabolism (24)
membrane (12)
Transcription related (11)
activator (7)
repressor (6)
Read more >
Regulated operon(s) adiC, amn, argP, asr, cra, cusCFBA, cusRS, edd-eda, feaR, gadAXW, hiuH, mipA, ompF, phnCDEFGHIJKLMNOP, phoA-psiF, phoBR, phoE, phoH, phoPQ, pitB, prpR, psiE, pstSCAB-phoU, rcdB, sbcDC, talA-tktB, ugpBAECQ, waaH, ydfH, yegH, ytfK
First gene in the operon(s) adiC, amn, argP, asr, cra, cusC, cusR, eda, feaR, gadX, hiuH, mipA, ompF, phnC, phoA, phoB, phoE, phoH, phoQ, phoU, pitB, prpR, psiE, pstS, sbcD, tktB, ugpB, ydfH, yegH, rcdB, waaH, ytfK
Simple and complex regulons ArgP,PhoB
Read more >
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)

Transcription factor regulation    

Transcription factor binding sites (TFBSs) arrangements

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence
LeftPos RightPos Evidence (Confirmed, Strong, Weak) References
  PhoB-Phosphorylated activator adiCp7 Sigma32 nd nd adiC nd nd [BPP], [GEA], [IGI] [2]
  PhoB-Phosphorylated activator amnp1 nd -33.0 -63.0 amn
2054989 2055007 [AIBSCS], [GEA] [3]
  PhoB-Phosphorylated activator argPp nd -27.0 -50.0 argP
3059694 3059712 [APIORCISFBSCS], [GEA] [4]
  PhoB-Phosphorylated activator asrp Sigma70 -30.0 -79.0 asr
1671288 1671306 [APIORCISFBSCS], [BCE], [GEA] [5]
  PhoB-Phosphorylated activator asrp2 Sigma38 -30.0 -79.0 asr
1671288 1671306 [APIORCISFBSCS], [BCE], [GEA] [5]
  PhoB-Phosphorylated activator cusCp Sigma70 -54.0 -81.0 cusC, cusF, cusB, cusA
595510 595528 [APIORCISFBSCS], [BPP], [GEA] [6]
  PhoB-Phosphorylated activator cusRp Sigma70 -57.0 -76.0 cusR, cusS
595510 595528 [APIORCISFBSCS], [BPP], [GEA] [6]
  PhoB-Phosphorylated repressor edap3 nd -53.0 -81.0 eda
1932827 1932848 [APIORCISFBSCS], [BPP], [GEA] [7]
  PhoB-Phosphorylated repressor feaRp2 Sigma70 -17.0 -43.0 feaR
1447317 1447335 [APIORCISFBSCS], [BPP], [GEA] [6]
  PhoB-Phosphorylated repressor fruRp8 Sigma32 nd nd cra nd nd [BPP], [GEA], [IGI] [2]
  PhoB-Phosphorylated activator gadXp Sigma38 nd nd gadX, gadW nd nd [BPP], [GEA], [IGI] [2]
  PhoB-Phosphorylated activator hiuHp Sigma70 nd nd hiuH nd nd [BPP], [GEA], [IGI] [6]
  PhoB-Phosphorylated activator mipAp nd -146.5 -180.5 mipA
1866643 1866663 [APIORCISFBSCS], [BPP], [GEA] [6]
  PhoB-Phosphorylated activator ompFp Sigma70 nd nd ompF nd nd [BPP], [GEA], [IGI] [2]
  PhoB-Phosphorylated activator ompFp2 Sigma38 nd nd ompF nd nd [BPP], [GEA], [IGI] [2]
  PhoB-Phosphorylated activator phnCp Sigma70 nd nd phnC, phnD, phnE, phnF, phnG, phnH, phnI, phnJ, phnK, phnL, phnM, phnN, phnO, phnP nd nd [BPP], [GEA], [IGI] [2], [8], [9]
  PhoB-Phosphorylated activator phoAp Sigma70 -31.0 -71.0 phoA, psiF
401667 401685 [BCE], [GEA], [SM] [2]
  PhoB-Phosphorylated activator phoBp Sigma70 -31.0 -72.0 phoB, phoR
417061 417079 [APIORCISFBSCS], [BPP], [GEA] [2], [6]
  PhoB-Phosphorylated activator phoEp Sigma70 -113.0 -171.0 phoE
260261 260281 [BCE], [GEA], [SM] [2]
  PhoB-Phosphorylated activator phoEp Sigma70 -88.0 -146.0 phoE
260237 260255 [BCE], [GEA], [SM] [2]
  PhoB-Phosphorylated activator phoEp Sigma70 -32.0 -90.0 phoE
260181 260199 [BCE], [GEA], [SM] [2]
  PhoB-Phosphorylated activator phoHp1 Sigma70 -31.0 -158.0 phoH
1084825 1084843 [APIORCISFBSCS], [BPP], [GEA] [2], [10]
  PhoB-Phosphorylated activator phoQp5 Sigma24 nd nd phoQ nd nd [BPP], [GEA], [IGI] [2]
  PhoB-Phosphorylated activator phoUp Sigma70 nd nd phoU nd nd [BPP], [GEA], [IGI] [2]
  PhoB-Phosphorylated repressor pitBp Sigma70 nd nd pitB nd nd [BPP], [GEA], [IGI] [11]
  PhoB-Phosphorylated repressor prpRp Sigma70 -24.0 -52.0 prpR
348486 348504 [APIORCISFBSCS], [BPP], [GEA] [6]
  PhoB-Phosphorylated activator psiEp Sigma70 -53.0 -78.0 psiE
4240238 4240256 [APIORCISFBSCS], [BPP], [GEA] [12]
  PhoB-Phosphorylated activator psiEp Sigma70 -31.0 -56.0 psiE
4240260 4240278 [APIORCISFBSCS], [BPP], [GEA] [12]
  PhoB-Phosphorylated activator pstSp Sigma70 -54.0 -97.0 pstS, pstC, pstA, pstB, phoU
3911613 3911631 [APIORCISFBSCS], [BCE], [GEA], [SM] [2], [13]
  PhoB-Phosphorylated activator pstSp Sigma70 -32.0 -75.0 pstS, pstC, pstA, pstB, phoU
3911591 3911609 [APIORCISFBSCS], [BCE], [GEA], [SM] [2], [13]
  PhoB-Phosphorylated activator pstSp2 Sigma38 -54.0 -97.0 pstS, pstC, pstA, pstB, phoU
3911613 3911631 [APIORCISFBSCS], [BCE], [GEA], [SM] [2], [13]
  PhoB-Phosphorylated activator pstSp2 Sigma38 -32.0 -75.0 pstS, pstC, pstA, pstB, phoU
3911591 3911609 [APIORCISFBSCS], [BCE], [GEA], [SM] [2], [13]
  PhoB-Phosphorylated repressor sbcDp Sigma70 -93.0 -118.0 sbcD, sbcC
417061 417079 [APIORCISFBSCS], [BPP], [GEA] [6]
  PhoB-Phosphorylated activator tktBp Sigma38 nd nd tktB nd nd [BPP], [GEA], [IGI] [2]
  PhoB-Phosphorylated activator ugpBp1 Sigma70 -52.0 -105.0 ugpB, ugpA, ugpE, ugpC, ugpQ
3592421 3592439 [BPP], [APIORCISFBSCS], [BPP], [GEA] [2], [14]
  PhoB-Phosphorylated activator ugpBp1 Sigma70 -30.0 -83.0 ugpB, ugpA, ugpE, ugpC, ugpQ
3592399 3592417 [APIORCISFBSCS], [BPP], [GEA] [2], [14]
  PhoB-Phosphorylated repressor ugpBp2 Sigma70 -26.0 -127.0 ugpB, ugpA, ugpE, ugpC, ugpQ
3592443 3592461 [APIORCISFBSCS], [BPP] [14]
  PhoB-Phosphorylated repressor ugpBp2 Sigma70 -4.0 -105.0 ugpB, ugpA, ugpE, ugpC, ugpQ
3592421 3592439 [APIORCISFBSCS], [BPP], [GEA] [14]
  PhoB-Phosphorylated activator ydfHp nd -20.0 -46.0 ydfH
1628297 1628315 [APIORCISFBSCS], [BPP], [GEA] [6]
  PhoB-Phosphorylated activator yegHp nd nd nd yegH nd nd [BPP], [GEA], [IGI] [6]
  PhoB-Phosphorylated activator yhjCp Sigma54 nd nd rcdB nd nd [BPP], [GEA], [IGI] [6]
  PhoB-Phosphorylated activator yibDp1 Sigma70 -113.0 -181.0 waaH
3790249 3790276 [AIBSCS], [GEA] [3]
  PhoB-Phosphorylated activator yibDp1 Sigma70 -59.5 -127.5 waaH
3790199 3790219 [AIBSCS], [GEA] [3]
  PhoB-Phosphorylated activator ytfKp Sigma38 -58.0 -134.0 ytfK
4439444 4439462 [APIORCISFBSCS], [GEA] [3], [15]
  PhoB-Phosphorylated activator ytfKp Sigma38 -36.0 -112.0 ytfK
4439466 4439484 [APIORCISFBSCS], [GEA] [3], [15]

Alignment and PSSM for PhoB TFBSs    

Aligned TFBS of PhoB   

Position weight matrix (PWM). PhoB matrix-quality result   
A	13	5	9	4	1	15	4	22	4	8	2	3	1	12	3	3	12	6	24	7
C	3	4	3	1	2	1	20	1	3	6	3	1	1	4	4	2	2	13	1	5
G	2	4	9	2	13	4	0	1	11	0	1	3	1	9	1	14	4	4	0	11
T	8	13	5	19	10	6	2	2	8	12	20	19	23	1	18	7	8	3	1	3

;	consensus.strict             	atgtgaCAgtttTgtgacAg
;	consensus.strict.rc          	CTGTCACAAAACTGTCACAT
;	consensus.IUPAC              	wtrtkaCAkhttTrtgwcAg
;	consensus.IUPAC.rc           	CTGWCAYAAADMTGTMAYAW
;	consensus.regexp             	[at]t[ag]t[gt]aCA[gt][act]ttT[ag]tg[at]cAg
;	consensus.regexp.rc          	CTG[AT]CA[CT]AAA[AGT][AC]TGT[AC]A[CT]A[AT]

PWM logo   


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation


 [1] Yamamoto K., Hirao K., Oshima T., Aiba H., Utsumi R., Ishihama A., 2005, Functional characterization in vitro of all two-component signal transduction systems from Escherichia coli., J Biol Chem 280(2):1448-56

 [2] Marzan LW., Hasan CM., Shimizu K., 2013, Effect of acidic condition on the metabolic regulation of Escherichia coli and its phoB mutant., Arch Microbiol 195(3):161-71

 [3] Baek JH., Lee SY., 2006, Novel gene members in the Pho regulon of Escherichia coli., FEMS Microbiol Lett 264(1):104-9

 [4] Han JS., Park JY., Lee YS., Thony B., Hwang DS., 1999, PhoB-dependent transcriptional activation of the iciA gene during starvation for phosphate in Escherichia coli., Mol Gen Genet 262(3):448-52

 [5] Suziedeliene E., Suziedelis K., Garbenciute V., Normark S., 1999, The acid-inducible asr gene in Escherichia coli: transcriptional control by the phoBR operon., J Bacteriol 181(7):2084-93

 [6] Yang C., Huang TW., Wen SY., Chang CY., Tsai SF., Wu WF., Chang CH., 2012, Genome-wide PhoB binding and gene expression profiles reveal the hierarchical gene regulatory network of phosphate starvation in Escherichia coli., PLoS One 7(10):e47314

 [7] Murray EL., Conway T., 2005, Multiple regulators control expression of the Entner-Doudoroff aldolase (Eda) of Escherichia coli., J Bacteriol 187(3):991-1000

 [8] Makino K., Kim SK., Shinagawa H., Amemura M., Nakata A., 1991, Molecular analysis of the cryptic and functional phn operons for phosphonate use in Escherichia coli K-12., J Bacteriol 173(8):2665-72

 [9] Wanner BL., Boline JA., 1990, Mapping and molecular cloning of the phn (psiD) locus for phosphonate utilization in Escherichia coli., J Bacteriol 172(3):1186-96

 [10] Kim SK., Makino K., Amemura M., Shinagawa H., Nakata A., 1993, Molecular analysis of the phoH gene, belonging to the phosphate regulon in Escherichia coli., J Bacteriol 175(5):1316-24

 [11] Harris RM., Webb DC., Howitt SM., Cox GB., 2001, Characterization of PitA and PitB from Escherichia coli., J Bacteriol 183(17):5008-14

 [12] Kim SK., Kimura S., Shinagawa H., Nakata A., Lee KS., Wanner BL., Makino K., 2000, Dual transcriptional regulation of the Escherichia coli phosphate-starvation-inducible psiE gene of the phosphate regulon by PhoB and the cyclic AMP (cAMP)-cAMP receptor protein complex., J Bacteriol 182(19):5596-9

 [13] Miyake Y., Yamamoto K., 2020, Epistatic Effect of Regulators to the Adaptive Growth of Escherichia coli., Sci Rep 10(1):3661

 [14] Kasahara M., Makino K., Amemura M., Nakata A., Shinagawa H., 1991, Dual regulation of the ugp operon by phosphate and carbon starvation at two interspaced promoters., J Bacteriol 173(2):549-58

 [15] Yoshida Y., Sugiyama S., Oyamada T., Yokoyama K., Kim SK., Makino K., 2011, Identification of PhoB binding sites of the yibD and ytfK promoter regions in Escherichia coli., J Microbiol 49(2):285-9

 [16] Makino K., Shinagawa H., Amemura M., Kimura S., Nakata A., Ishihama A., 1988, Regulation of the phosphate regulon of Escherichia coli. Activation of pstS transcription by PhoB protein in vitro., J Mol Biol 203(1):85-95

 [17] Makino K., Shinagawa H., Amemura M., Nakata A., 1986, Nucleotide sequence of the phoB gene, the positive regulatory gene for the phosphate regulon of Escherichia coli K-12., J Mol Biol 190(1):37-44

 [18] Kimura S., Makino K., Shinagawa H., Amemura M., Nakata A., 1989, Regulation of the phosphate regulon of Escherichia coli: characterization of the promoter of the pstS gene., Mol Gen Genet 215(3):374-80
