RegulonDB RegulonDB 10.9:Regulon Page
   

ArgR DNA-binding transcriptional dual regulator

Synonyms: ArgR, ArgR-L-arginine
Summary:
ArgR complexed with L-arginine represses the transcription of several genes involved in biosynthesis and transport of arginine, transport of histidine, and its own synthesis [1, 2, 7] and activates genes for arginine catabolism [12]. ArgR is also essential for a site-specific recombination reaction that resolves plasmid ColE1 multimers to monomers and is necessary for plasmid stability [3]. The role of ArgR in this latter reaction may be structural [3]. The hexamer is the active form of ArgR, and L-arginine binds to ArgR and stabilizes the hexamer [9] and increases its DNA affinity by allosteric activation [9]. ArgR belongs to the ArgR/AhrC family, whose members are widely distributed in bacteria [16].
Read more >


Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
ArgR Non-Functional   Apo [BPP], [GEA], [IDA], [IPI] [1], [2], [3], [4], [5]
ArgR-L-arginine Functional Allosteric Holo [APPHINH], [BPP], [GEA], [HIFS], [IDA], [IPI] [1], [2], [4], [6], [7], [8], [9]
Evolutionary Family: ArgR
Sensing class: Sensing external and internal signals
Connectivity class: Local Regulator
Gene name: argR
  Genome position: 3384703-3385173
  Length: 471 bp / 156 aa
Operon name: argR
TU(s) encoding the TF:
Transcription unit        Promoter
argR
argRp1
argR
argRp2


Regulon       
Regulated gene(s) argA, argB, argC, argD, argE, argF, argG, argH, argI, argR, artI, artJ, artM, artP, artQ, astA, astB, astC, astD, astE, carA, carB, gltB, gltD, gltF, hisJ, hisM, hisP, hisQ, infB, lysO, metY, nusA, pnp, rbfA, rimP, rpsO, truB
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
arginine (16)
amino acids (5)
ABC superfamily, membrane component (4)
membrane (4)
other (mechanical, nutritional, oxidative stress) (4)
Read more >
Regulated operon(s) argA, argCBH, argD, argE, argF, argG, argI, argR, argT-hisJQMP, artJ, artPIQM, astCADBE, carAB, gltBDF, lysO, metY-rimP-nusA-infB-rbfA-truB-rpsO-pnp
First gene in the operon(s) argA, argC, argD, argE, argF, argG, argI, argR, artJ, artP, astC, carA, gltB, hisJ, lysO, metY
Simple and complex regulons AdiY,ArgR,CRP,FNR,Fur,GadE,HdfR,IHF,Lrp,Nac
ArgR
ArgR,CRP
ArgR,DksA-ppGpp,ppGpp
ArgR,H-NS
Read more >
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)
[ArgR,+](1)
[ArgR,-](16)


Transcription factor regulation    


Transcription factor binding sites (TFBSs) arrangements
      

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence LeftPos RightPos Evidence (Confirmed, Strong, Weak) References
  ArgR-L-arginine repressor argAp Sigma70 46.5 -40.5 argA
ctgcgaaaaaACAGAATAAAAATACACTAatttcgaata
2949193 2949211 [AIBSCS], [APIORCISFBSCS], [BPP], [GEA] [1], [7]
  ArgR-L-arginine repressor argAp Sigma70 67.5 -19.5 argA
atacactaatTTCGAATAATCATGCAAAGaggtgtgccg
2949214 2949231 [EME], [AIBSCS], [AIBSPD], [APIORCISFBSCS], [BPP], [CEE], [GEA] [1], [7]
  ArgR-L-arginine repressor argCp Sigma70 -3.5 -119.5 argC, argB, argH
ggtcatgataGTATCAATATTCATGCAGTatttatgaat
4154873 4154890 [AIBSCS], [BCE], [BPP], [GEA], [SM] [7]
  ArgR-L-arginine repressor argCp Sigma70 19.5 -97.5 argC, argB, argH
atgcagtattTATGAATAAAAATACACTAacgttgagcg
4154895 4154912 [EME], [AIBSCS], [AIBSPD], [BCE], [BPP], [CEE], [GEA], [SM] [1], [7]
  ArgR-L-arginine repressor argDp Sigma70 -19.5 -60.5 argD
gattgccattTAGTGATTTTTTATGCATAttttgtggtt
3490232 3490249 [AIBSCS], [APIORCISFBSCS], [BPP], [GEA] [1], [7]
  ArgR-L-arginine repressor argDp Sigma70 2.5 -39.5 argD
tatgcatattTTGTGGTTATAATTTCACAtttgtttatg
3490211 3490228 [EME], [AIBSCS], [AIBSPD], [BPP], [CEE] [1], [7]
  ArgR-L-arginine repressor argEp1 Sigma70 -6.5 -56.5 argE
cgctcaacgtTAGTGTATTTTTATTCATAaatactgcat
4154895 4154912 [EME], [AIBSCS], [AIBSPD], [BCE], [BPP], [CEE], [GEA], [SM] [1], [7]
  ArgR-L-arginine repressor argEp1 Sigma70 16.5 -34.5 argE
attcataaatACTGCATGAATATTGATACtatcatgacc
4154873 4154890 [AIBSCS], [BCE], [BPP], [GEA], [SM] [1], [7]
  ArgR-L-arginine repressor argFp Sigma70 -22.5 -57.5 argF
atggggttgcAAATGAATAATTACACATAtaaagtgaat
290354 290371 [AIBSCS], [BCE], [BPP], [GEA] [1], [7], [10]
  ArgR-L-arginine repressor argFp Sigma70 -1.5 -36.5 argF
tacacatataAAGTGAATTTTAATTCAATaagtggcgtt
290333 290350 [EME], [AIBSCS], [AIBSPD], [BPP], [CEE], [GEA], [SM] [1], [5], [7]
  ArgR-L-arginine repressor argGp Sigma70 -125.5 -200.5 argG
ttgctaatcaTGTGAATGAATATCCAGTTcactttcatt
3318428 3318445 [AIBSCS], [APIORCISFBSCS], [BPP], [GEA] [1], [7], [11]
  ArgR-L-arginine repressor argGp Sigma70 -6.5 -81.5 argG
ataaaagatgATTAAATGAAAACTCATTTattttgcata
3318547 3318564 [AIBSCS], [APIORCISFBSCS], [BPP], [GEA] [1], [7], [11]
  ArgR-L-arginine repressor argGp Sigma70 15.5 -60.5 argG
actcatttatTTTGCATAAAAATTCAGTGagagcggaaa
3318568 3318585 [AIBSCS], [APIORCISFBSCS], [BPP], [GEA] [1], [7], [11]
  ArgR-L-arginine repressor argIp Sigma70 -22.5 -55.5 argI
ttagacttgcAAATGAATAATCATCCATAtaaattgaat
4478358 4478375 [AIBSCS], [BCE], [BPP], [GEA] [1], [7]
  ArgR-L-arginine repressor argIp Sigma70 -1.5 -34.5 argI
catccatataAATTGAATTTTAATTCATTgaggcgttag
4478337 4478354 [EME], [AIBSCS], [AIBSPD], [BCE], [BPP], [CEE], [GEA] [1], [7]
  ArgR-L-arginine repressor argRp1 Sigma70 -27.5 -53.5 argR
gggctgactgTTTGCATAAAAATTCATCTgtatgcacaa
3384641 3384658 [AIBSCS], [APIORCISFBSCS], [BPP], [GEA] [1], [7], [10]
  ArgR-L-arginine repressor argRp1 Sigma70 -7.5 -33.5 argR
aattcatctgTATGCACAATAATGTTGTAtcaaccacca
3384661 3384678 [EME], [AIBSCS], [AIBSPD], [APIORCISFBSCS], [BPP], [CEE], [GEA] [1], [7], [10]
  ArgR-L-arginine repressor artJp Sigma70 -48.5 -99.5 artJ
ttttatttcaTTTAAATTATTTAATCATGtttattgcat
900666 900684 [EME], [AIBSPD], [BPP], [CEE], [GEA], [SM] [1], [6]
  ArgR-L-arginine repressor artJp Sigma70 -27.5 -78.5 artJ
taatcatgttTATTGCATATAAATTCACTtgatggcatt
900645 900663 [AIBSCS], [BPP], [GEA], [SM] [1], [6]
  ArgR-L-arginine repressor artPp Sigma70 -50.5 -85.5 artP, artI, artQ, artM
tgcgctttgcTTTTAACTTTTAAAGCAGAaatattgcat
903811 903829 [EME], [AIBSPD], [BPP], [CEE], [EME], [GEA], [SM] [1], [6]
  ArgR-L-arginine repressor artPp Sigma70 -29.5 -64.5 artP, artI, artQ, artM
aaagcagaaaTATTGCATAATTATTCTGTcaaaggtact
903790 903808 [AIBSCS], [BPP], [GEA], [SM] [1], [6]
  ArgR-L-arginine activator astCp2 Sigma54 -121.5 -183.5 astC, astA, astD, astB, astE
tattcacccaCATCGCAAACGTATTCACTttatatgcac
1832157 1832174 [EME], [AIBSCS], [AIBSPD], [BPP], [CEE], [GEA] [1], [12]
  ArgR-L-arginine activator astCp2 Sigma54 -99.5 -161.5 astC, astA, astD, astB, astE
attcactttaTATGCACTTTAAATGCATAtggtttggtt
1832135 1832152 [AIBSCS], [BPP], [GEA] [12]
  ArgR-L-arginine activator astCp2 Sigma54 -78.5 -140.5 astC, astA, astD, astB, astE
aatgcatatgGTTTGGTTATAACTCCTTGatttccagtt
1832114 1832131 [AIBSCS], [BPP], [GEA] [12]
  ArgR-L-arginine activator astCp2 Sigma54 -47.5 -109.5 astC, astA, astD, astB, astE
ttccagttagCCTCCGCCGTTTATGCACTtttatcactg
1832083 1832100 [AIBSCS], [BPP], [GEA] [12]
  ArgR-L-arginine repressor carAp2 Sigma70 -8.5 -40.5 carA, carB
acgtcatcatTGTGAATTAATATGCAAATaaagtgagtg
29602 29619 [AIBSCS], [APIORCISFBSCS], [BPP], [GEA], [SM] [1], [7]
  ArgR-L-arginine repressor carAp2 Sigma70 13.5 -19.5 carA, carB
atgcaaataaAGTGAGTGAATATTCTCTGgagggtgttt
29623 29640 [EME], [AIBSCS], [AIBSPD], [APIORCISFBSCS], [BPP], [CEE], [GEA], [SM] [1], [7]
  ArgR-L-arginine repressor gltBp Sigma70 -352.0 -568.0 gltB, gltD, gltF
gcttttatcaACTGCATAATCAATCAAAAttaccgaaat
3354148 3354165 [APIORCISFBSCS], [BPP], [GEA] [13], [14]
  ArgR-L-arginine repressor gltBp Sigma70 -331.5 -547.5 gltB, gltD, gltF
aatcaaaattACCGAAATTTCATGCATAAtcacataaat
3354169 3354186 [APIORCISFBSCS], [BPP], [GEA] [13], [14]
  ArgR-L-arginine repressor gltBp2 Sigma38 -352.0 -568.0 gltB, gltD, gltF
gcttttatcaACTGCATAATCAATCAAAAttaccgaaat
3354148 3354165 [APIORCISFBSCS], [BPP], [GEA] [13], [14]
  ArgR-L-arginine repressor gltBp2 Sigma38 -331.5 -547.5 gltB, gltD, gltF
aatcaaaattACCGAAATTTCATGCATAAtcacataaat
3354169 3354186 [APIORCISFBSCS], [BPP], [GEA] [13], [14]
  ArgR-L-arginine repressor hisJp Sigma70 -83.5 -132.5 hisJ, hisQ, hisM, hisP
tggtgcattgAAATGCATACTTAAGCATTtttaatgaaa
2426912 2426930 [EME], [AIBSPD], [BPP], [CEE], [GEA], [SM] [1], [6]
  ArgR-L-arginine repressor hisJp Sigma70 -62.5 -111.5 hisJ, hisQ, hisM, hisP
taagcattttTAATGAAAAATAATACGTCtaacggggcg
2426891 2426909 [AIBSCS], [BPP], [GEA], [SM] [1], [6]
  ArgR-L-arginine repressor lysOp Sigma70 -55.5 -93.5 lysO
ctactgctccTTATGCATAACATTTCCTTttaattgcaa
914942 914959 [EME], [AIBSPD], [BPP], [CEE], [GEA], [SM] [1], [15]
  ArgR-L-arginine repressor lysOp Sigma70 -34.5 -72.5 lysO
atttccttttAATTGCAACTTTACTCGTCcttccgcttt
914921 914938 [BPP], [GEA], [SM] [15]
  ArgR-L-arginine repressor metYp2 Sigma70 -201.5 -287.5 metY, rimP, nusA, infB, rbfA, truB, rpsO, pnp
tttccgctctCACTGAATTTTTATGCAAAataaatgagt
3318568 3318585 [AIBSCS], [APIORCISFBSCS], [BPP], [GEA] [11]
  ArgR-L-arginine repressor metYp2 Sigma70 -180.5 -266.5 metY, rimP, nusA, infB, rbfA, truB, rpsO, pnp
tatgcaaaatAAATGAGTTTTCATTTAATcatcttttat
3318547 3318564 [AIBSCS], [APIORCISFBSCS], [BPP], [GEA] [11]
  ArgR-L-arginine repressor metYp2 Sigma70 -61.5 -147.5 metY, rimP, nusA, infB, rbfA, truB, rpsO, pnp
aatgaaagtgAACTGGATATTCATTCACAtgattagcaa
3318428 3318445 [AIBSCS], [APIORCISFBSCS], [BPP], [GEA] [11]



High-throughput Transcription factor binding sites (TFBSs)
      

  Functional conformation Function Object name Object type Distance to first Gene Sequence LeftPos RightPos Center Position Growth Condition Evidence (Confirmed, Strong, Weak) References
  ArgR-L-arginine activator gltP Gene nd
nd
4294256 4294295 4294275.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine activator ykgA Gene nd
nd
316883 316922 316902.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine activator gltP Gene nd
nd
4294288 4294327 4294307.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine activator yaaU Gene nd
nd
45774 45813 45793.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine activator puuB Gene nd
nd
1364244 1364283 1364263.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine activator eutS Gene nd
nd
2575928 2575967 2575947.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine activator yraQ Gene nd
nd
3298201 3298240 3298220.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine activator gltP Gene nd
nd
4294147 4294186 4294166.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine activator aroP Gene nd
nd
121792 121831 121811.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine activator yffB Gene nd
nd
2591207 2591246 2591226.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine repressor waaA Gene nd
nd
3808394 3808433 3808413.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine repressor yhcC Transcription-Unit nd
tttatgtgatTATGCATGAAATTTCGGTAATTTTGATTGATTATGCAGTtgataaaagc
3354148 3354187 3354167.0 nd [EME], [AIBSCS], [AIBSPD], [BPP], [CEE], [GEA] [1], [13]
  ArgR-L-arginine repressor hchA Gene nd
nd
2035484 2035523 2035503.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine repressor stpA Gene nd
nd
2798743 2798782 2798762.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine repressor cvpA Gene nd
nd
2430869 2430908 2430888.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine repressor dacC Gene nd
nd
880767 880806 880786.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine repressor gltB Gene nd
nd
3354541 3354580 3354560.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine repressor mcaS Gene nd
nd
1405819 1405858 1405838.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine repressor pyrL Gene nd
nd
4472623 4472662 4472642.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine repressor aroK Gene nd
nd
3519202 3519241 3519221.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine repressor hisL Gene nd
nd
2089964 2090003 2089983.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine repressor lrp Gene nd
nd
932353 932392 932372.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine repressor ftsZ Gene nd
nd
105232 105271 105251.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine repressor hchA Gene nd
nd
2035538 2035577 2035557.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine repressor dps Gene nd
nd
849151 849190 849170.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine repressor mukE Gene nd
nd
975739 975778 975758.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine repressor potF Gene nd
nd
893697 893736 893716.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine repressor pfkB Gene nd
nd
1806222 1806261 1806241.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine repressor ydgI Gene nd
nd
1679490 1679529 1679509.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine repressor yfcC Gene nd
nd
2416994 2417033 2417013.0 nd [EME], [AIBSPD], [CEE] [1]
Other High-throughput regulatory interactions with weak evidence


Alignment and PSSM for ArgR TFBSs    

Aligned TFBS of ArgR   
  Sequence
  TATTTTGCATAAAAATTCAGT
  TTTATTGCATATAAATTCACT
  AATATTGCATAATTATTCTGT
  CTGTTTGCATAAAAATTCATC
  CTTATTGAATTAAAATTCACT
  TTATATGGATGATTATTCATT
  TTATTTGCATATTAATTCACA
  AAATATGCATAAAAAATCACT
  ATTTATGAATAAAAATACACT
  TAAATTGAATTTTAATTCATT
  TCATGTGAATGAATATCCAGT
  AATTTTGATTGATTATGCAGT
  TTATATGTGTAATTATTCATT
  GATTATGCATGAAATTTCGGT
  AAAAATGCTTAAGTATGCATT
  TAAAGTGAGTGAATATTCTCT
  AATACTGCATGAATATTGATA
  CTCTTTGCATGATTATTCGAA
  ATTAGTGTATTTTTATTCTGT
  TTTTGTGGTTATAATTTCACA
  CCTTATGCATAACATTTCCTT
  ATGATTAAATGAAAACTCATT
  TTTAATGAAAAATAATACGTC
  CTGTATGCACAATAATGTTGT
  ATTTCTGCTTTAAAAGTTAAA
  CCATATGCATTTAAAGTGCAT
  TAAAGTGAATACGTTTGCGAT
  TTAATTGCAACTTTACTCGTC
  AAACATGATTAAATAATTTAA
  TGGTTTGGTTATAACTCCTTG
  AAAAGTGCATAAACGGCGGAG

Position weight matrix (PWM). ArgR matrix-quality result   
A	11	12	13	13	11	0	1	10	23	2	17	22	17	17	25	2	2	0	17	6	6
C	6	3	1	1	2	0	0	16	0	1	1	1	1	1	1	2	3	25	2	7	3
G	1	1	4	0	6	0	30	3	2	0	8	0	2	0	1	3	4	3	6	7	2
T	13	15	13	17	12	31	0	2	6	28	5	8	11	13	4	24	22	3	6	11	20

Consensus   
;	consensus.strict             	ttattTGcaTaaaaattCatt
;	consensus.strict.rc          	AATGAATTTTTATGCAAATAA
;	consensus.IUPAC              	wwwwwTGmaTrawwattCabt
;	consensus.IUPAC.rc           	AVTGAATWWTYATKCAWWWWW
;	consensus.regexp             	[at][at][at][at][at]TG[ac]aT[ag]a[at][at]attCa[cgt]t
;	consensus.regexp.rc          	A[ACG]TGAAT[AT][AT]T[CT]AT[GT]CA[AT][AT][AT][AT][AT]

PWM logo   


 


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation




Reference(s)    

 [1] Caldara M., Charlier D., Cunin R., 2006, The arginine regulon of Escherichia coli: whole-system transcriptome analysis discovers new genes and provides an integrated view of arginine regulation., Microbiology 152(Pt 11):3343-54

 [2] Lim DB., Oppenheim JD., Eckhardt T., Maas WK., 1987, Nucleotide sequence of the argR gene of Escherichia coli K-12 and isolation of its product, the arginine repressor., Proc Natl Acad Sci U S A 84(19):6697-701

 [3] Stirling CJ., Szatmari G., Stewart G., Smith MC., Sherratt DJ., 1988, The arginine repressor is essential for plasmid-stabilizing site-specific recombination at the ColE1 cer locus., EMBO J 7(13):4389-95

 [4] Szwajkajzer D., Dai L., Fukayama JW., Abramczyk B., Fairman R., Carey J., 2001, Quantitative analysis of DNA binding by the Escherichia coli arginine repressor., J Mol Biol 312(5):949-62

 [5] Tian G., Maas WK., 1994, Mutational analysis of the arginine repressor of Escherichia coli., Mol Microbiol 13(4):599-608

 [6] Caldara M., Minh PN., Bostoen S., Massant J., Charlier D., 2007, ArgR-dependent repression of arginine and histidine transport genes in Escherichia coli K-12., J Mol Biol 373(2):251-67

 [7] Charlier D., Roovers M., Van Vliet F., Boyen A., Cunin R., Nakamura Y., Glansdorff N., Pierard A., 1992, Arginine regulon of Escherichia coli K-12. A study of repressor-operator interactions and of in vitro binding affinities versus in vivo repression., J Mol Biol 226(2):367-86

 [8] Tian G., Lim D., Carey J., Maas WK., 1992, Binding of the arginine repressor of Escherichia coli K12 to its operator sites., J Mol Biol 226(2):387-97

 [9] Van Duyne GD., Ghosh G., Maas WK., Sigler PB., 1996, Structure of the oligomerization and L-arginine binding domain of the arginine repressor of Escherichia coli., J Mol Biol 256(2):377-91

 [10] Levitt M., 1992, Accurate modeling of protein conformation by automatic segment matching., J Mol Biol 226(2):507-33

 [11] Krin E., Laurent-Winter C., Bertin PN., Danchin A., Kolb A., 2003, Transcription regulation coupling of the divergent argG and metY promoters in Escherichia coli K-12., J Bacteriol 185(10):3139-46

 [12] Kiupakis AK., Reitzer L., 2002, ArgR-independent induction and ArgR-dependent superinduction of the astCADBE operon in Escherichia coli., J Bacteriol 184(11):2940-50

 [13] Cho S., Cho YB., Kang TJ., Kim SC., Palsson B., Cho BK., 2015, The architecture of ArgR-DNA complexes at the genome-scale in Escherichia coli., Nucleic Acids Res 43(6):3079-88

 [14] Paul L., Mishra PK., Blumenthal RM., Matthews RG., 2007, Integration of regulatory signals through involvement of multiple global regulators: control of the Escherichia coli gltBDF operon by Lrp, IHF, Crp, and ArgR., BMC Microbiol 7:2

 [15] Pathania A., Sardesai AA., 2015, Distinct Paths for Basic Amino Acid Export in Escherichia coli: YbjE (LysO) Mediates Export of L-Lysine., J Bacteriol 197(12):2036-47

 [16] Makarova KS., Mironov AA., Gelfand MS., 2001, Conservation of the binding site for the arginine repressor in all bacterial lineages., Genome Biol 2(4):RESEARCH0013



RegulonDB