RegulonDB RegulonDB 10.9:Regulon Page

NagC DNA-binding transcriptional dual regulator

Synonyms: NagC-N-acetyl-D-glucosamine 6-phosphate, NagC
The NagC, "N-acetylglucosamine," transcriptional dual regulator participates in regulating the phosphotransferase system (PTS) [] Its function is to coordinate the biosynthesis of the amino sugars, D-glucosamine (GlcN) and N-acetylglucosamine (GlcNAc) with their catabolism [3, 6, 7]. The specific inducer for NagC is GlcNAc-6-P, the product of GlcNAc transport by the PTS [7] NagC is displaced from its DNA targets by interacting with GlcNAc-6-P [7] Mutation in the first two amino acids of the recognition helix of the DNA-binding motif causes GlcNAc6P to act with NagC as a corepressor instead of as an inducer [16]. Proline at the first position of this helix seems to contribute to the distinction between the NagC binding sites and suboptimal sites [16]. Based on the structure of |FRAME: PD01896|, models for the three-dimensional structure of NagC and for the binding of GlcNAc-6-P were developed [] The Nag regulon consists of two divergent operons, nagE and nagBACD.
Read more >

Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
NagC Functional   Apo [APPH], [BPP], [IMP] [1], [2], [3], [4], [5], [6], [7], [8], [9], [10]
NagC-N-acetyl-D-glucosamine 6-phosphate Non-Functional Allosteric Holo [BPP], [IMP] [7]
Evolutionary Family: MarR
Sensing class: External sensing using transported metabolites
Connectivity class: Local Regulator
Gene name: nagC
  Genome position: 700374-701594
  Length: 1221 bp / 406 aa
Operon name: nagBAC-umpH
TU(s) encoding the TF:
Transcription unit        Promoter

Regulated gene(s) chbA, chbB, chbC, chbF, chbG, chbR, chiP, chiQ, creA, creB, creC, creD, crr, dinI, feoA, feoB, feoC, fimB, galP, glmS, glmU, manX, manY, manZ, nagA, nagB, nagC, nagE, nanC, nanM, nanS, ptsH, ptsI, umpH, ydeM, ydeN, ydeP
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
carbon compounds (14)
membrane (9)
Phosphotransferase Systems (PEP-dependent PTS) (8)
amino sugar conversions (5)
operon (4)
Read more >
Regulated operon(s) chbBCARFG, chiPQ, creABCD, dinI, feoABC, fimB, galP, glmUS, manXYZ, nagBAC-umpH, nagE, nanCMS, ptsHI-crr, ydeNM, ydeP
First gene in the operon(s) chbB, chiP, creA, dinI, feoA, fimB, galP, glmU, manX, nagB, nagE, nanC, ptsH, ydeN, ydeP
Simple and complex regulons AraC,GadX,NagC
Read more >
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)

Transcription factor regulation    

Transcription factor binding sites (TFBSs) arrangements

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence LeftPos RightPos Evidence (Confirmed, Strong, Weak) References
  NagC repressor chbBp nd -112.0 -219.0 chbB, chbC, chbA, chbR, chbF, chbG
1821827 1821849 [AIBSCS], [APIORCISFBSCS], [BPP], [GEA], [SM] [6]
  NagC repressor chbBp nd 1.0 -107.0 chbB, chbC, chbA, chbR, chbF, chbG
1821715 1821737 [APIORCISFBSCS], [BPP], [GEA] [6]
  NagC repressor chiPp nd -244.0 -342.0 chiP, chiQ
707980 708004 [BPP], [GEA] [11]
  NagC repressor chiPp nd -22.0 -120.0 chiP, chiQ
708203 708225 [AIBSCS], [BPP], [GEA]
  NagC repressor creAp Sigma70 2.0 -43.0 creA, creB, creC, creD
4635467 4635489 [AIBSCS]
  NagC repressor dinIp Sigma70 -14.0 -36.0 dinI
1121512 1121534 [AIBSCS]
  NagC unknown feoAp Sigma70 -128.0 -234.0 feoA, feoB, feoC
3539918 3539940 [AIBSCS]
  NagC activator fimBp2 nd -674.0 -964.0 fimB
4539982 4540004 [AIBSCS], [APIORCISFBSCS], [BPP], [GEA], [SM] [9], [10]
  NagC activator fimBp2 nd -462.0 -752.0 fimB
4540194 4540216 [AIBSCS], [APIORCISFBSCS], [BPP], [SM] [9]
  NagC repressor galPp Sigma70 2.0 -28.0 galP
3088245 3088267 [AIBSCS], [BPP], [SM] [12]
  NagC activator glmUp1 Sigma70 -199.0 -222.0 glmU, glmS
3915411 3915433 [APIORCISFBSCS], [BPP], [SM] [4]
  NagC activator glmUp1 Sigma70 -46.0 -69.0 glmU, glmS
3915258 3915280 [APIORCISFBSCS], [BPP], [SM] [4]
  NagC repressor glmUp2 Sigma70 -96.0 -222.0 glmU, glmS
3915411 3915433 [APIORCISFBSCS], [BPP], [SM] [4]
  NagC repressor glmUp2 Sigma70 58.0 -69.0 glmU, glmS
3915258 3915280 [APIORCISFBSCS], [BPP], [SM] [4]
  NagC repressor manXp Sigma70 -80.0 -195.0 manX, manY, manZ
1901842 1901864 [AIBSCS], [APIORCISFBSCS], [BCE], [GEA] [5], [13]
  NagC repressor manXp Sigma70 4.0 -112.0 manX, manY, manZ
1901925 1901947 [BCE], [GEA] [5], [13]
  NagC repressor nagBp Sigma70 -101.0 -198.0 nagB, nagA, nagC, umpH
703798 703820 [BPP], [GEA], [SM] [3], [5], [14], [15]
  NagC repressor nagBp Sigma70 -7.0 -104.0 nagB, nagA, nagC, umpH
703704 703726 [BPP], [GEA], [SM] [3], [5], [14], [15]
  NagC repressor nagEp Sigma70 -125.0 -229.0 nagE
703704 703726 [BPP], [GEA], [SM] [3], [14], [15], [16]
  NagC repressor nagEp Sigma70 -31.0 -135.0 nagE
703798 703820 [BPP], [GEA], [SM] [3], [14], [15], [16]
  NagC repressor nanCp nd -277.0 -704.0 nanC, nanM, nanS
4540194 4540216 [AIBSCS], [APIORCISFBSCS], [BPP], [SM]
  NagC repressor nanCp nd -65.0 -492.0 nanC, nanM, nanS
4539982 4540004 [AIBSCS], [APIORCISFBSCS], [BPP], [GEA], [SM] [1]
  NagC repressor ptsHp Sigma32 13.0 -251.0 ptsH, ptsI, crr
2533502 2533524 [AIBSCS], [APIORCISFBSCS], [BPP], [GEA] [17]
  NagC repressor ptsHp3 nd 7.0 -251.0 ptsH, ptsI, crr
2533502 2533524 [AIBSCS], [APIORCISFBSCS], [BPP], [GEA] [17]
  NagC repressor ptsHp4 Sigma70 13.0 -251.0 ptsH, ptsI, crr
2533502 2533524 [AIBSCS], [APIORCISFBSCS], [BPP], [GEA] [17]
  NagC repressor ptsHp5 Sigma32 16.0 -251.0 ptsH, ptsI, crr
2533502 2533524 [APIORCISFBSCS], [BPP], [GEA]
  NagC repressor ydeNp Sigma70 -140.0 -170.0 ydeN, ydeM
1582683 1582705 [AIBSCS]
  NagC repressor ydeNp Sigma70 -16.0 -46.0 ydeN, ydeM
1582559 1582581 [AIBSCS]
  NagC repressor ydePp Sigma70 -28.0 -206.0 ydeP
1586681 1586703 [AIBSCS]

High-throughput Transcription factor binding sites (TFBSs)

  Functional conformation Function Object name Object type Distance to first Gene Sequence LeftPos RightPos Center Position Growth Condition Evidence (Confirmed, Strong, Weak) References
  NagC unknown eutSPQTDM Transcription-Unit nd
nd nd nd nd [BPP], [GEA], [IGI] nd

Alignment and PSSM for NagC TFBSs    

Aligned TFBS of NagC   

Position weight matrix (PWM). NagC matrix-quality result   
A	15	4	8	4	17	6	1	0	0	7	4	4	13	7	5	9	9	19	20	10	3	18	10	3	9
C	1	6	1	1	0	0	0	0	15	0	10	3	3	6	0	6	0	1	0	0	2	0	2	9	6
G	2	4	0	0	0	1	0	0	0	12	0	11	1	2	11	2	7	0	0	3	2	2	3	5	0
T	2	6	11	15	3	13	19	20	5	1	6	2	3	5	4	3	4	0	0	7	13	0	5	3	5

;	consensus.strict             	acttAtTTCGcgacgagAAatAaca
;	consensus.strict.rc          	TGTTATTTCTCGTCGCGAAATAAGT
;	consensus.IUPAC              	aywtAwTTCRygamgmrAAwtAasm
;	consensus.regexp             	a[ct][at]tA[at]TTC[AG][ct]ga[ac]g[ac][ag]AA[at]tAa[cg][ac]
;	consensus.regexp.rc          	[GT][CG]TTA[AT]TT[CT][GT]C[GT]TC[AG][CT]GAA[AT]TA[AT][AG]T

PWM logo   


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation


 [1] Condemine G., Berrier C., Plumbridge J., Ghazi A., 2005, Function and expression of an N-acetylneuraminic acid-inducible outer membrane channel in Escherichia coli., J Bacteriol 187(6):1959-65

 [2] Peri KG., Goldie H., Waygood EB., 1990, Cloning and characterization of the N-acetylglucosamine operon of Escherichia coli., Biochem Cell Biol 68(1):123-37

 [3] Plumbridge J., 2001, DNA binding sites for the Mlc and NagC proteins: regulation of nagE, encoding the N-acetylglucosamine-specific transporter in Escherichia coli., Nucleic Acids Res 29(2):506-14

 [4] Plumbridge J., 1995, Co-ordinated regulation of amino sugar biosynthesis and degradation: the NagC repressor acts as both an activator and a repressor for the transcription of the glmUS operon and requires two separated NagC binding sites., EMBO J 14(16):3958-65

 [5] Plumbridge J., Kolb A., 1991, CAP and Nag repressor binding to the regulatory regions of the nagE-B and manX genes of Escherichia coli., J Mol Biol 217(4):661-79

 [6] Plumbridge J., Pellegrini O., 2004, Expression of the chitobiose operon of Escherichia coli is regulated by three transcription factors: NagC, ChbR and CAP., Mol Microbiol 52(2):437-49

 [7] Plumbridge JA., 1991, Repression and induction of the nag regulon of Escherichia coli K-12: the roles of nagC and nagA in maintenance of the uninduced state., Mol Microbiol 5(8):2053-62

 [8] Plumbridge JA., 1989, Sequence of the nagBACD operon in Escherichia coli K12 and pattern of transcription within the nag regulon., Mol Microbiol 3(4):505-15

 [9] Sohanpal BK., El-Labany S., Lahooti M., Plumbridge JA., Blomfield IC., 2004, Integrated regulatory responses of fimB to N-acetylneuraminic (sialic) acid and GlcNAc in Escherichia coli K-12., Proc Natl Acad Sci U S A 101(46):16322-7

 [10] Sohanpal BK., Friar S., Roobol J., Plumbridge JA., Blomfield IC., 2007, Multiple co-regulatory elements and IHF are necessary for the control of fimB expression in response to sialic acid and N-acetylglucosamine in Escherichia coli K-12., Mol Microbiol 63(4):1223-36

 [11] Plumbridge J., Bossi L., Oberto J., Wade JT., Figueroa-Bossi N., 2014, Interplay of transcriptional and small RNA-dependent control mechanisms regulates chitosugar uptake in Escherichia coli and Salmonella., Mol Microbiol 92(4):648-58

 [12] El Qaidi S., Allemand F., Oberto J., Plumbridge J., 2009, Repression of galP, the galactose transporter in Escherichia coli, requires the specific regulator of N-acetylglucosamine metabolism., Mol Microbiol 71(1):146-57

 [13] Plumbridge J., 1998, Control of the expression of the manXYZ operon in Escherichia coli: Mlc is a negative regulator of the mannose PTS., Mol Microbiol 27(2):369-80

 [14] Plumbridge J., Kolb A., 1993, DNA loop formation between Nag repressor molecules bound to its two operator sites is necessary for repression of the nag regulon of Escherichia coli in vivo., Mol Microbiol 10(5):973-81

 [15] Plumbridge J., Kolb A., 1998, DNA bending and expression of the divergent nagE-B operons., Nucleic Acids Res 26(5):1254-60

 [16] Fernandez M., Plumbridge J., 2019, Complex synergistic amino acid-nucleotide interactions contribute to the specificity of NagC operator recognition and induction., Microbiology 165(7):792-803

 [17] Oberto J., 2010, FITBAR: a web tool for the robust prediction of prokaryotic regulons., BMC Bioinformatics 11:554

 [18] Cho S., Shin D., Ji GE., Heu S., Ryu S., 2005, High-level recombinant protein production by overexpression of Mlc in Escherichia coli., J Biotechnol 119(2):197-203
