![]() ![]() |
Synonyms: GntR, GntR-D-gluconate |
Summary:
The Gluconate repressor," GntR, is a transcription factor that negatively regulates the operon involved in the catabolism of D-gluconate via the Entner-Doudoroff pathway and also represses genes involved in two different systems related to D-gluconate uptake: gluconate I and gluconate II [3, 7, 8, 9]. This regulator is part of the gntRKU operon, yet it can also be constitutively expressed as an independent (gntR) transcription unit [1, 10]. Gluconate I is considered the main system for transport of D-gluconate and contains genes that encode high- and low-affinity gluconate transporters [4, 5, 8, 11, 12]. The D-gluconate II system is capable of transport of L-idonate and also is regulated by IdnR; the genes involved in this system encode another high-affinity gluconate transporter [3, 7, 8, 9]. In addition, the genes regulated are induced when Escherichia coli is grown in the presence of the inducer, D-gluconate, and in the absence of glucose. Read more > |
Transcription factor | ![]() ![]() |
||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
TF conformation(s): |
|
||||||||||||||||||
Evolutionary Family: | GalR/LacI | ||||||||||||||||||
Sensing class: | Sensing external and internal signals | ||||||||||||||||||
Connectivity class: | Local Regulator | ||||||||||||||||||
Gene name: | gntR | ||||||||||||||||||
Genome position: | 3577731-3578726 | ||||||||||||||||||
Length: | 996 bp / 331 aa | ||||||||||||||||||
Operon name: | gntRKU | ||||||||||||||||||
TU(s) encoding the TF: |
|
Regulon |
![]() ![]() |
||||||
---|---|---|---|---|---|---|---|
Regulated gene(s) | eda, edd, gntK, gntT, gntU, idnD, idnK, idnO, idnR, idnT, nfuA, yhgH | ||||||
Multifun term(s) of regulated gene(s) |
MultiFun Term (List of genes associated to the multifun term)
carbon compounds (5)
Porters (Uni-, Sym- and Antiporters) (3)
membrane (3)
Entner-Doudoroff (2)
glyoxylate degradation (1)
Read more >
|
||||||
Regulated operon(s) | edd-eda, gntRKU, gntT, idnDOTR, idnK, yhgH-nfuA | ||||||
First gene in the operon(s) | edd, gntK, gntT, yhgH, idnD, idnK | ||||||
Simple and complex regulons | CRP,GntR CRP,GntR,IdnR Cra,GntR,KdgR | ||||||
Simple and complex regulatory phrases | Regulatory phrase (List of promoters regulated by the phrase) |
Transcription factor regulation |
![]() |
---|
Functional conformation | Function | Promoter | Sigma factor | Central Rel-Pos | Distance to first Gene | Genes | Sequence | LeftPos | RightPos | Evidence (Confirmed, Strong, Weak) | References | |
---|---|---|---|---|---|---|---|---|---|---|---|---|
GntR | repressor | eddp | Sigma70 | -93.5 | -202.5 | edd, eda |
tcctttatggTTATTTTACCGGTAACATGAtcttgcgcag
|
1934797 | 1934816 | [AIBSCS], [APIORCISFBSCS], [BPP] | [2] | |
GntR | repressor | eddp | Sigma70 | 128.5 | 19.5 | edd, eda |
tatgaatccaCAATTGTTACGCGTAACAAAtcgaatcatt
|
1934576 | 1934595 | [APIORCISFBSCS], [BPP], [SM] | [2] | |
GntR | repressor | gntKp | Sigma70 | 2.5 | -51.5 | gntK, gntU |
tccggctggaCAATGTTACCGATAACAGTTacccgtaaca
|
3577634 | 3577653 | [GEA], [AIBSCS], [APIORCISFBSCS], [BPP], [SM] | [1], [3] | |
GntR | repressor | gntKp | Sigma70 | 15.5 | -38.5 | gntK, gntU |
tgttaccgatAACAGTTACCCGTAACATTTttaattcttg
|
3577621 | 3577640 | [GEA], [AIBSCS], [APIORCISFBSCS], [BPP], [SM] | [3] | |
GntR | repressor | gntTp1 | Sigma70 | -14.5 | -168.5 | gntT |
ctcaaacgccAGATGTTACCCGTATCATTCacatgggtac
|
3546381 | 3546400 | [GEA], [TASES], [AIBSCS], [APIORCISFBSCS], [BPP], [TASES] | [4], [5], [6] | |
GntR | repressor | gntTp1 | Sigma70 | 127.5 | -27.5 | gntT |
gtcagaaaatTGACGTTACCCATAACAAATgaaaggccag
|
3546522 | 3546541 | [GEA], [TASES], [AIBSCS], [APIORCISFBSCS], [BPP], [TASES] | [5], [6] | |
GntR | repressor | gntTp2 | nd | -55.5 | -168.5 | gntT |
ctcaaacgccAGATGTTACCCGTATCATTCacatgggtac
|
3546381 | 3546400 | [GEA], [TASES], [AIBSCS], [APIORCISFBSCS], [BPP], [TASES] | [4], [5], [6] | |
GntR | repressor | gntTp2 | nd | 86.5 | -27.5 | gntT |
gtcagaaaatTGACGTTACCCATAACAAATgaaaggccag
|
3546522 | 3546541 | [GEA], [TASES], [AIBSCS], [APIORCISFBSCS], [BPP], [TASES] | [5], [6] | |
GntR | repressor | gntTp3 | nd | -58.5 | -168.5 | gntT |
ctcaaacgccAGATGTTACCCGTATCATTCacatgggtac
|
3546381 | 3546400 | [GEA], [TASES], [AIBSCS], [APIORCISFBSCS], [BPP], [TASES] | [4], [5], [6] | |
GntR | repressor | gntTp3 | nd | 83.5 | -27.5 | gntT |
gtcagaaaatTGACGTTACCCATAACAAATgaaaggccag
|
3546522 | 3546541 | [GEA], [TASES], [AIBSCS], [APIORCISFBSCS], [BPP], [TASES] | [5], [6] | |
GntR | repressor | gntXp | Sigma70 | -15.0 | -230.0 | yhgH, nfuA |
ctgttgcagcACGGCTTCGGCCATATCAGCaagtgacagc
|
3544642 | 3544661 | [AIBSCS] | ||
GntR | repressor | idnDp | nd | -108.5 | -137.5 | idnD, idnO, idnT, idnR |
cacgttttttTATTTCTACTGATAAGAATTacaaggcaca
|
4494534 | 4494553 | [GEA], [AIBSCS], [APIORCISFBSCS] | [7] | |
GntR | repressor | idnDp | nd | -78.5 | -107.5 | idnD, idnO, idnT, idnR |
acaaggcacaTCACGTTATGCGTAACATAGtaatgtaaca
|
4494504 | 4494523 | [GEA], [AIBSCS], [APIORCISFBSCS] | [7] | |
GntR | repressor | idnDp | nd | -58.5 | -87.5 | idnD, idnO, idnT, idnR |
cgtaacatagTAATGTAACAATTTTCTGACgtgatcttca
|
4494484 | 4494503 | [GEA], [APIORCISFBSCS] | [7] | |
GntR | repressor | idnKp | Sigma70 | -103.5 | -129.5 | idnK |
tgaagatcacGTCAGAAAATTGTTACATTActatgttacg
|
4494484 | 4494503 | [GEA], [APIORCISFBSCS] | [7] | |
GntR | repressor | idnKp | Sigma70 | -83.5 | -109.5 | idnK |
tgttacattaCTATGTTACGCATAACGTGAtgtgccttgt
|
4494504 | 4494523 | [GEA], [AIBSCS], [APIORCISFBSCS] | [7] | |
GntR | repressor | idnKp | Sigma70 | -53.5 | -79.5 | idnK |
tgtgccttgtAATTCTTATCAGTAGAAATAaaaaaacgtg
|
4494534 | 4494553 | [GEA], [AIBSCS], [APIORCISFBSCS] | [7] |
Alignment and PSSM for GntR TFBSs | ![]() |
---|
Aligned TFBS of GntR |
---|
Sequence | |
---|---|
CAGTTACCCGTAACATTTTTAA | |
ATGTTACCGGTAAAATAACCAT | |
ATGTTACCCGTATCATTCACAT | |
ACGTTACCCATAACAAATGAAA | |
ACGTTATGCGTAACATAGTAAT | |
TTGTTACGCGTAACAAATCGAA | |
TTGTAATTCTTATCAGTAGAAA | |
CAGAAAATTGTTACATTACTAT | |
ACGGCTTCGGCCATATCAGCAA |
Position weight matrix (PWM). GntR matrix-quality result |
---|
A 5 2 0 1 2 8 1 0 0 1 0 7 7 1 9 2 4 4 1 3 9 5 C 2 3 0 0 1 0 5 5 6 0 1 1 0 7 0 0 1 1 3 3 0 0 G 0 0 9 1 0 0 0 2 2 7 0 0 0 0 0 1 0 1 3 1 0 0 T 2 4 0 7 6 1 3 2 1 1 8 1 2 1 0 6 4 3 2 2 0 4 |
Consensus |
---|
; consensus.strict acGttAccCGTaaCAtaagcAa ; consensus.strict.rc TTGCTTATGTTACGGGTAACGT ; consensus.IUPAC myGttAysSGTaaCAtwwsmAw ; consensus.IUPAC.rc WTKSWWATGTTACSSRTAACRK ; consensus.regexp [ac][ct]GttA[ct][cg][CG]GTaaCAt[at][at][cg][ac]A[at] ; consensus.regexp.rc [AT]T[GT][CG][AT][AT]ATGTTAC[CG][CG][AG]TAAC[AG][GT] |
Evolutionary conservation of regulatory elements | ![]() |
---|
Reference(s) |
![]() |
---|---|