RegulonDB RegulonDB 11.1:Regulon Page
   

TrpR DNA-binding transcriptional repressor

Synonyms: TrpR, TrpR-L-tryptophan
Summary:
TrpR, "tryptophan (trp) transcriptional repressor," negatively regulates expression of the trp regulon in response to intracellular levels of tryptophan [13, 15]. The TrpR regulon is involved in tryptophan biosynthesis, transport, and regulation. This regulon partially overlaps with the TyrR regulon, since expression of several genes is regulated by TrpR and TyrR, the transcriptional regulator of the TyrR regulon [8, 10, 11] TrpR represses transcription by interfering with the ability of RNA polymerase to interact with the promoter [15] The aporepressor is activated as a DNA-binding protein by noncooperative binding of two L-tryptophan molecules to the homodimer [15, 16, 17] The consensus sequence for TrpR is described as two symmetrically arranged half-sites with the sequence GNACT separated by a spacer of 8 bp [5] Nonspecific sequences appear to assist TrpR binding to the specific site, because it was observed, by footprinting assay, that the affinity of the specific site increased when the length of sequence used in the experiment was longer [14]. X-ray crystallography of the aporepressor [18] the holorepressor [19] and repressor bound to the operator oligonucleotide [20]as well as NMR studies of the repressor and aporepressor in solution [21]and bound to an operator oligonucleotide [22]reveal that the small 25-kDa protein belongs to the helix-turn-helix (HTH) family.
Read more >


Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) References
TrpR Non-Functional   Apo nd nd nd
TrpR-L-tryptophan Functional Allosteric Holo nd nd nd
Evolutionary Family: TrpR
TFBs length: 18
Sensing class: Sensing external and internal signals
Connectivity class: Local Regulator
Gene name: trpR
  Genome position: 4632760-4633086
  Length: 327 bp / 108 aa
Operon name: trpR
TU(s) encoding the TF:
Transcription unit        Promoter
trpR
trpRp


Regulon       
Regulated gene(s) aroH, aroL, aroM, mtr, trpA, trpB, trpC, trpD, trpE, trpL, trpR, yaiA
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
tryptophan (9)
chorismate (1)
Porters (Uni-, Sym- and Antiporters) (1)
membrane (1)
Transcription related (1)
Read more >
Regulated operon(s) aroH, aroL-yaiA-aroM, mtr, trpLEDCBA, trpR
First gene in the operon(s) aroH, aroL, mtr, trpL, trpR
Simple and complex regulons HU,IHF,TrpR,TyrR
TrpR
TrpR,TyrR
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)
[TrpR,-](5)


Transcription factor regulation    


Transcription factor binding sites (TFBSs) arrangements
      

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence LeftPos RightPos Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) References
  TrpR-L-tryptophan repressor aroHp1 Sigma70 -37.5 -154.5 aroH
gtcgccgaatGTACTAGAGAACTAGTGCattagcttat
 1788272 1788289 [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] S [1], [2], [2], [3], [3], [4], [4], [5], [5], [6]
  TrpR-L-tryptophan repressor aroHp1 Sigma70 -29.5 -146.5 aroH
atgtactagaGAACTAGTGCATTAGCTTatttttttgt
 1788280 1788297 [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] S [1], [2], [2], [3], [3], [4], [4], [5], [5], [6]
  TrpR-L-tryptophan repressor aroLp1 Sigma70 48.5 -77.5 aroL, yaiA, aroM
ttctttacaaTCGAAATTGTACTAGTTTgatggtatga
 406319 406336 [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION] C [2], [2], [5], [5], [7], [7], [8], [8]
  TrpR-L-tryptophan repressor aroLp1 Sigma70 56.5 -69.5 aroL, yaiA, aroM
aatcgaaattGTACTAGTTTGATGGTATgatcgctatt
 406327 406344 [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION] C [2], [2], [5], [5], [7], [7], [8], [8]
  TrpR-L-tryptophan repressor mtrp2 Sigma70 -19.5 -62.5 mtr
tctgtcttttGTACTCGTGTACTGGTACagtgcaatgc
 3305871 3305888 [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IEP-MICROARRAY], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-CHIP-CHIP-MANUAL], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] C [2], [2], [9], [9], [10], [11], [11]
  TrpR-L-tryptophan repressor mtrp2 Sigma70 -11.5 -54.5 mtr
ttgtactcgtGTACTGGTACAGTGCAATgcataacaac
 3305863 3305880 [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IEP-MICROARRAY], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-CHIP-CHIP-MANUAL], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] C [2], [2], [9], [9], [10], [11], [11]
  TrpR-L-tryptophan repressor trpLp Sigma70 -19.5 -45.5 trpL, trpE, trpD, trpC, trpB, trpA
tgttgacaatTAATCATCGAACTAGTTAactagtacgc
 1323119 1323136 [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION] C [2], [2], [3], [3], [4], [4], [5], [5], [6], [12]
  TrpR-L-tryptophan repressor trpLp Sigma70 -11.5 -37.5 trpL, trpE, trpD, trpC, trpB, trpA
attaatcatcGAACTAGTTAACTAGTACgcaagttcac
 1323111 1323128 [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION] C [2], [2], [3], [3], [4], [4], [5], [5], [6], [12], [12]
  TrpR-L-tryptophan repressor trpLp Sigma70 -3.5 -29.5 trpL, trpE, trpD, trpC, trpB, trpA
tcgaactagtTAACTAGTACGCAAGTTCacgtaaaaag
 1323103 1323120 [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION] C [2], [2], [3], [3], [4], [4], [5], [5], [6], [12], [12]
  TrpR-L-tryptophan repressor trpRp Sigma70 -0.5 -56.5 trpR
atatgctatcGTACTCTTTAGCGAGTACaaccggggga
 4632695 4632712 [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] S [2], [2], [3], [3], [4], [4], [5], [5], [6], [13], [13], [14], [14]


Alignment and PSSM for TrpR TFBSs    

Aligned TFBS of TrpR   
  Sequence
  ACTTGCGTACTAGTTAACTAG
  ATCATCGAACTAGTTAACTAG
  ACTAGAGAACTAGTGCATTAG
  TGCACTGTACCAGTACACGAG
  ACTCGCTAAAGAGTACGATAG
  GAAATTGTACTAGTTTGATGG

Position weight matrix (PWM). TrpR matrix-quality result    
A	4	1	1	4	0	1	0	3	6	1	0	6	0	0	2	2	4	2	0	5	0
C	0	3	2	1	1	3	0	0	0	5	1	0	0	0	0	3	0	3	0	0	0
G	1	1	0	0	3	0	5	0	0	0	1	0	6	0	1	0	2	0	1	1	6
T	1	1	3	1	2	2	1	3	0	0	4	0	0	6	3	1	0	1	5	0	0

Consensus    
;	consensus.strict             	actagcGaACtAGTtcactaG
;	consensus.strict.rc          	CTAGTGAACTAGTTCGCTAGT
;	consensus.IUPAC              	acyakyGwACtAGTwmrmtaG
;	consensus.IUPAC.rc           	CTAKYKWACTAGTWCRMTRGT
;	consensus.regexp             	ac[ct]a[gt][ct]G[at]ACtAGT[at][ac][ag][ac]taG
;	consensus.regexp.rc          	CTA[GT][CT][GT][AT]ACTAGT[AT]C[AG][AC]T[AG]GT

PWM logo   


 


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation


Evidence    

 [EXP-IEP-GENE-EXPRESSION-ANALYSIS] Gene expression analysis

 [COMP-HINF-SIMILAR-TO-CONSENSUS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] Binding of purified proteins

 [EXP-IMP-SITE-MUTATION] Site mutation

 [EXP-IEP-MICROARRAY] high throughput expression microarray evidence

 [EXP-CHIP-CHIP-MANUAL] ChIP-chip evidence used in manual assertion


Reference(s)    

 [1] Grove CL., Gunsalus RP., 1987, Regulation of the aroH operon of Escherichia coli by the tryptophan repressor., J Bacteriol 169(5):2158-64

 [2] Jeeves M., Evans PD., Parslow RA., Jaseja M., Hyde EI., 1999, Studies of the Escherichia coli Trp repressor binding to its five operators and to variant operator sequences., Eur J Biochem 265(3):919-28

 [3] Klig LS., Carey J., Yanofsky C., 1988, trp repressor interactions with the trp aroH and trpR operators. Comparison of repressor binding in vitro and repression in vivo., J Mol Biol 202(4):769-77

 [4] Kumamoto AA., Miller WG., Gunsalus RP., 1987, Escherichia coli tryptophan repressor binds multiple sites within the aroH and trp operators., Genes Dev 1(6):556-64

 [5] Yang J., Gunasekera A., Lavoie TA., Jin L., Lewis DE., Carey J., 1996, In vivo and in vitro studies of TrpR-DNA interactions., J Mol Biol 258(1):37-52

 [6] Bass S., Sugiono P., Arvidson DN., Gunsalus RP., Youderian P., 1987, DNA specificity determinants of Escherichia coli tryptophan repressor binding., Genes Dev 1(6):565-72

 [7] Heatwole VM., Somerville RL., 1992, Synergism between the Trp repressor and Tyr repressor in repression of the aroL promoter of Escherichia coli K-12., J Bacteriol 174(1):331-5

 [8] Lawley B., Pittard AJ., 1994, Regulation of aroL expression by TyrR protein and Trp repressor in Escherichia coli K-12., J Bacteriol 176(22):6921-30

 [9] Cho BK., Federowicz S., Park YS., Zengler K., Palsson BO., 2011, Deciphering the transcriptional regulatory logic of amino acid metabolism., Nat Chem Biol 8(1):65-71

 [10] Heatwole VM., Somerville RL., 1991, The tryptophan-specific permease gene, mtr, is differentially regulated by the tryptophan and tyrosine repressors in Escherichia coli K-12., J Bacteriol 173(11):3601-4

 [11] Sarsero JP., Wookey PJ., Pittard AJ., 1991, Regulation of expression of the Escherichia coli K-12 mtr gene by TyrR protein and Trp repressor., J Bacteriol 173(13):4133-43

 [12] Kinebuchi T., Shimamoto N., 2021, One-dimensional diffusion of TrpR along DNA enhances its affinity for the operator by chemical ratchet mechanism., Sci Rep 11(1):4255

 [13] Gunsalus RP., Yanofsky C., 1980, Nucleotide sequence and expression of Escherichia coli trpR, the structural gene for the trp aporepressor., Proc Natl Acad Sci U S A 77(12):7117-21

 [14] Shimamoto N., Toda M., Nara S., Komatsuzaki T., Kamagata K., Kinebuchi T., Tomizawa JI., 2020, Dependence of DNA length on binding affinity between TrpR and trpO of DNA., Sci Rep 10(1):15624

 [15] Squires CL, Lee FD, Yanofsky C, 1975, Interaction of the trp repressor and RNA polymerase with the trp operon., J Mol Biol, 92(1):93 10.1016/0022-2836(75)90093-5

 [16] Lane AN, 1986, The interaction of the trp repressor from Escherichia coli with L-tryptophan and indole propanoic acid., Eur J Biochem, 157(2):405 10.1111/j.1432-1033.1986.tb09682.x

 [17] Marmorstein RQ, Joachimiak A, Sprinzl M, Sigler PB, 1987, The structural basis for the interaction between L-tryptophan and the Escherichia coli trp aporepressor., J Biol Chem, 262(10):4922 None

 [18] Zhang RG., Joachimiak A., Lawson CL., Schevitz RW., Otwinowski Z., Sigler PB., 1987, The crystal structure of trp aporepressor at 1.8 A shows how binding tryptophan enhances DNA affinity., Nature 327(6123):591-7

 [19] Schevitz RW, Otwinowski Z, Joachimiak A, Lawson CL, Sigler PB, 1985, The three-dimensional structure of trp repressor., Nature, 317(6040):782 10.1038/317782a0

 [20] Otwinowski Z, Schevitz RW, Zhang RG, Lawson CL, Joachimiak A, Marmorstein RQ, Luisi BF, Sigler PB, 1988, Crystal structure of trp repressor/operator complex at atomic resolution., Nature, 335(6188):321 10.1038/335321a0

 [21] Zhao D, Arrowsmith CH, Jia X, Jardetzky O, 1993, Refined solution structures of the Escherichia coli trp holo- and aporepressor., J Mol Biol, 229(3):735 10.1006/jmbi.1993.1076

 [22] Ramesh V, Frederick RO, Syed SE, Gibson CF, Yang JC, Roberts GC, 1994, The interactions of Escherichia coli trp repressor with tryptophan and with an operator oligonucleotide. NMR studies using selectively 15N-labelled protein., Eur J Biochem, 225(2):601 10.1111/j.1432-1033.1994.00601.x

 [23] Tripet BP, Goel A, Copie V, 2011, Internal dynamics of the tryptophan repressor (TrpR) and two functionally distinct TrpR variants, L75F-TrpR and A77V-TrpR, in their l-Trp-bound forms., Biochemistry, 50(23):5140 10.1021/bi200389k


RegulonDB