![]() ![]() |
Synonyms: TrpR, TrpR-L-tryptophan |
Summary:
TrpR, "tryptophan (trp) transcriptional repressor," negatively regulates expression of the trp regulon in response to intracellular levels of tryptophan [12, 14]. The TrpR regulon is involved in tryptophan biosynthesis, transport, and regulation. This regulon partially overlaps with the TyrR regulon, since expression of several genes is regulated by TrpR and TyrR, the transcriptional regulator of the TyrR regulon [7, 9, 10] TrpR represses transcription by interfering with the ability of RNA polymerase to interact with the promoter [14] The aporepressor is activated as a DNA-binding protein by noncooperative binding of two L-tryptophan molecules to the homodimer [14, 15, 16] The consensus sequence for TrpR is described as two symmetrically arranged half-sites with the sequence GNACT separated by a spacer of 8 bp [5] Nonspecific sequences appear to assist TrpR binding to the specific site, because it was observed, by footprinting assay, that the affinity of the specific site increased when the length of sequence used in the experiment was longer [13]. X-ray crystallography of the aporepressor [17] the holorepressor [18] and repressor bound to the operator oligonucleotide [19]as well as NMR studies of the repressor and aporepressor in solution [20]and bound to an operator oligonucleotide [21]reveal that the small 25-kDa protein belongs to the helix-turn-helix (HTH) family. Read more > |
Transcription factor | ![]() ![]() |
|||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
TF conformation(s): |
|
|||||||||||||||||||||
Evolutionary Family: | TrpR | |||||||||||||||||||||
TFBs length: | 18 | |||||||||||||||||||||
Sensing class: | Sensing external and internal signals | |||||||||||||||||||||
Connectivity class: | Local Regulator | |||||||||||||||||||||
Gene name: | trpR | |||||||||||||||||||||
Genome position: | 4632760-4633086 | |||||||||||||||||||||
Length: | 327 bp / 108 aa | |||||||||||||||||||||
Operon name: | trpR | |||||||||||||||||||||
TU(s) encoding the TF: |
|
Regulon |
![]() ![]() |
||||||
---|---|---|---|---|---|---|---|
Regulated gene(s) | aroH, aroL, aroM, mtr, trpA, trpB, trpC, trpD, trpE, trpL, trpR, yaiA | ||||||
Multifun term(s) of regulated gene(s) |
MultiFun Term (List of genes associated to the multifun term)
tryptophan (9)
chorismate (1)
Porters (Uni-, Sym- and Antiporters) (1)
membrane (1)
Transcription related (1)
Read more >
|
||||||
Regulated operon(s) | aroH, aroL-yaiA-aroM, mtr, trpLEDCBA, trpR | ||||||
First gene in the operon(s) | aroH, aroL, mtr, trpL, trpR | ||||||
Simple and complex regulons | HU,IHF,TrpR,TyrR TrpR TrpR,TyrR | ||||||
Simple and complex regulatory phrases | Regulatory phrase (List of promoters regulated by the phrase) |
Transcription factor regulation |
![]() |
---|
Alignment and PSSM for TrpR TFBSs | ![]() |
---|
Aligned TFBS of TrpR |
---|
Sequence | |
---|---|
ACTTGCGTACTAGTTAACTAG | |
ATCATCGAACTAGTTAACTAG | |
ACTAGAGAACTAGTGCATTAG | |
TGCACTGTACCAGTACACGAG | |
ACTCGCTAAAGAGTACGATAG | |
GAAATTGTACTAGTTTGATGG |
Position weight matrix (PWM). TrpR matrix-quality result |
---|
A 4 1 1 4 0 1 0 3 6 1 0 6 0 0 2 2 4 2 0 5 0 C 0 3 2 1 1 3 0 0 0 5 1 0 0 0 0 3 0 3 0 0 0 G 1 1 0 0 3 0 5 0 0 0 1 0 6 0 1 0 2 0 1 1 6 T 1 1 3 1 2 2 1 3 0 0 4 0 0 6 3 1 0 1 5 0 0 |
Consensus |
---|
; consensus.strict actagcGaACtAGTtcactaG ; consensus.strict.rc CTAGTGAACTAGTTCGCTAGT ; consensus.IUPAC acyakyGwACtAGTwmrmtaG ; consensus.IUPAC.rc CTAKYKWACTAGTWCRMTRGT ; consensus.regexp ac[ct]a[gt][ct]G[at]ACtAGT[at][ac][ag][ac]taG ; consensus.regexp.rc CTA[GT][CT][GT][AT]ACTAGT[AT]C[AG][AC]T[AG]GT |
Evolutionary conservation of regulatory elements | ![]() |
---|
Reference(s) |
![]() |
---|---|