RegulonDB RegulonDB 10.9:Regulon Page
   

TrpR DNA-binding transcriptional repressor

Synonyms: TrpR-tryptophan, TrpR
Summary:
TrpR, "tryptophan (trp) transcriptional repressor," negatively regulates expression of the trp regulon in response to intracellular levels of tryptophan [10]. The TrpR regulon is involved in tryptophan biosynthesis, transport, and regulation. This regulon partially overlaps with the TyrR regulon, since expression of several genes is regulated by TrpR and TyrR, the transcriptional regulator of the TyrR regulon [7, 8, 9] TrpR represses transcription by interfering with the ability of RNA polymerase to interact with the promoter [] The aporepressor is activated as a DNA-binding protein by noncooperative binding of two L-tryptophan molecules to the homodimer [] The consensus sequence for TrpR is described as two symmetrically arranged half-sites with the sequence GNACT separated by a spacer of 8 bp [2] X-ray crystallography of the aporepressor [11] the holorepressor [] and repressor bound to the operator oligonucleotide []as well as NMR studies of the repressor and aporepressor in solution []and bound to an operator oligonucleotide []reveal that the small 25-kDa protein belongs to the helix-turn-helix (HTH) family.
Read more >


Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
TrpR Non-Functional   Apo nd nd
TrpR-tryptophan Functional Allosteric Holo [APPHINH], [HIFS] [1], [2]
Evolutionary Family: TrpR
Sensing class: Sensing external and internal signals
Connectivity class: Local Regulator
Gene name: trpR
  Genome position: 4632760-4633086
  Length: 327 bp / 108 aa
Operon name: trpR
TU(s) encoding the TF:
Transcription unit        Promoter
trpR
trpRp


Regulon       
Regulated gene(s) aroH, aroL, aroM, mtr, trpA, trpB, trpC, trpD, trpE, trpL, trpR, yaiA
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
tryptophan (9)
chorismate (1)
Porters (Uni-, Sym- and Antiporters) (1)
membrane (1)
Transcription related (1)
Read more >
Regulated operon(s) aroH, aroL-yaiA-aroM, mtr, trpLEDCBA, trpR
First gene in the operon(s) aroH, aroL, mtr, trpL, trpR
Simple and complex regulons HU,IHF,TrpR,TyrR
TrpR
TrpR,TyrR
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)
[TrpR,-](5)


Transcription factor regulation    


Transcription factor binding sites (TFBSs) arrangements
      

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence LeftPos RightPos Evidence (Confirmed, Strong, Weak) References
  TrpR-tryptophan repressor aroHp1 Sigma70 -37.5 -154.5 aroH
gtcgccgaatGTACTAGAGAACTAGTGCAttagcttatt
 1788272 1788289 [APIORCISFBSCS], [BPP], [GEA] [1], [2], [3], [4], [5]
  TrpR-tryptophan repressor aroHp1 Sigma70 -29.5 -146.5 aroH
atgtactagaGAACTAGTGCATTAGCTTAtttttttgtt
 1788280 1788297 [APIORCISFBSCS], [BPP], [GEA] [1], [2], [3], [4], [5]
  TrpR-tryptophan repressor aroLp Sigma70 48.5 -77.5 aroL, yaiA, aroM
ttctttacaaTCGAAATTGTACTAGTTTGatggtatgat
 406319 406336 [APIORCISFBSCS], [BPP], [GEA], [SM] [2], [4], [6], [7]
  TrpR-tryptophan repressor aroLp Sigma70 56.5 -69.5 aroL, yaiA, aroM
aatcgaaattGTACTAGTTTGATGGTATGatcgctattc
 406327 406344 [APIORCISFBSCS], [BPP], [GEA], [SM] [2], [4], [6], [7]
  TrpR-tryptophan repressor mtrp2 Sigma70 -19.5 -62.5 mtr
ttctgtctttTGTACTCGTGTACTGGTACagtgcaatgc
 3305871 3305888 [APIORCISFBSCS], [BPP], [GEA] [4], [8], [9]
  TrpR-tryptophan repressor mtrp2 Sigma70 -11.5 -54.5 mtr
tttgtactcgTGTACTGGTACAGTGCAATgcataacaac
 3305863 3305880 [APIORCISFBSCS], [BPP], [GEA] [4], [8], [9]
  TrpR-tryptophan repressor trpLp Sigma70 -19.5 -45.5 trpL, trpE, trpD, trpC, trpB, trpA
ctgttgacaaTTAATCATCGAACTAGTTAactagtacgc
 1323119 1323136 [APIORCISFBSCS], [BPP], [GEA], [SM] [1], [2], [4], [5]
  TrpR-tryptophan repressor trpLp Sigma70 -11.5 -37.5 trpL, trpE, trpD, trpC, trpB, trpA
aattaatcatCGAACTAGTTAACTAGTACgcaagttcac
 1323111 1323128 [APIORCISFBSCS], [BPP], [GEA], [SM] [1], [2], [4], [5]
  TrpR-tryptophan repressor trpLp Sigma70 -3.5 -29.5 trpL, trpE, trpD, trpC, trpB, trpA
atcgaactagTTAACTAGTACGCAAGTTCacgtaaaaag
 1323103 1323120 [APIORCISFBSCS], [BPP], [GEA], [SM] [1], [2], [4], [5]
  TrpR-tryptophan repressor trpRp Sigma70 -0.5 -56.5 trpR
atatgctatcGTACTCTTTAGCGAGTACAaccgggggag
 4632695 4632712 [APIORCISFBSCS], [BPP], [GEA] [1], [2], [4], [5], [10]


Alignment and PSSM for TrpR TFBSs    

Aligned TFBS of TrpR   
  Sequence
  ACTTGCGTACTAGTTAACTAG
  ATCATCGAACTAGTTAACTAG
  ACTAGAGAACTAGTGCATTAG
  TGCACTGTACCAGTACACGAG
  ACTCGCTAAAGAGTACGATAG
  GAAATTGTACTAGTTTGATGG

Position weight matrix (PWM). TrpR matrix-quality result    
A	4	1	1	4	0	1	0	3	6	1	0	6	0	0	2	2	4	2	0	5	0
C	0	3	2	1	1	3	0	0	0	5	1	0	0	0	0	3	0	3	0	0	0
G	1	1	0	0	3	0	5	0	0	0	1	0	6	0	1	0	2	0	1	1	6
T	1	1	3	1	2	2	1	3	0	0	4	0	0	6	3	1	0	1	5	0	0

Consensus    
;	consensus.strict             	actagcGaACtAGTtcactaG
;	consensus.strict.rc          	CTAGTGAACTAGTTCGCTAGT
;	consensus.IUPAC              	acyakyGwACtAGTwmrmtaG
;	consensus.IUPAC.rc           	CTAKYKWACTAGTWCRMTRGT
;	consensus.regexp             	ac[ct]a[gt][ct]G[at]ACtAGT[at][ac][ag][ac]taG
;	consensus.regexp.rc          	CTA[GT][CT][GT][AT]ACTAGT[AT]C[AG][AC]T[AG]GT

PWM logo   


 


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation


Evidence    

 [APPHINH] Assay of protein purified to homogeneity from its native host

 [HIFS] Human inference of function from sequence

 [APIORCISFBSCS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [BPP] Binding of purified proteins

 [GEA] Gene expression analysis

 [SM] Site mutation


Reference(s)    

 [1] Kumamoto AA., Miller WG., Gunsalus RP., 1987, Escherichia coli tryptophan repressor binds multiple sites within the aroH and trp operators., Genes Dev 1(6):556-64

 [2] Yang J., Gunasekera A., Lavoie TA., Jin L., Lewis DE., Carey J., 1996, In vivo and in vitro studies of TrpR-DNA interactions., J Mol Biol 258(1):37-52

 [3] Grove CL., Gunsalus RP., 1987, Regulation of the aroH operon of Escherichia coli by the tryptophan repressor., J Bacteriol 169(5):2158-64

 [4] Jeeves M., Evans PD., Parslow RA., Jaseja M., Hyde EI., 1999, Studies of the Escherichia coli Trp repressor binding to its five operators and to variant operator sequences., Eur J Biochem 265(3):919-28

 [5] Klig LS., Carey J., Yanofsky C., 1988, trp repressor interactions with the trp aroH and trpR operators. Comparison of repressor binding in vitro and repression in vivo., J Mol Biol 202(4):769-77

 [6] Heatwole VM., Somerville RL., 1992, Synergism between the Trp repressor and Tyr repressor in repression of the aroL promoter of Escherichia coli K-12., J Bacteriol 174(1):331-5

 [7] Lawley B., Pittard AJ., 1994, Regulation of aroL expression by TyrR protein and Trp repressor in Escherichia coli K-12., J Bacteriol 176(22):6921-30

 [8] Heatwole VM., Somerville RL., 1991, The tryptophan-specific permease gene, mtr, is differentially regulated by the tryptophan and tyrosine repressors in Escherichia coli K-12., J Bacteriol 173(11):3601-4

 [9] Sarsero JP., Wookey PJ., Pittard AJ., 1991, Regulation of expression of the Escherichia coli K-12 mtr gene by TyrR protein and Trp repressor., J Bacteriol 173(13):4133-43

 [10] Gunsalus RP., Yanofsky C., 1980, Nucleotide sequence and expression of Escherichia coli trpR, the structural gene for the trp aporepressor., Proc Natl Acad Sci U S A 77(12):7117-21

 [11] Zhang RG., Joachimiak A., Lawson CL., Schevitz RW., Otwinowski Z., Sigler PB., 1987, The crystal structure of trp aporepressor at 1.8 A shows how binding tryptophan enhances DNA affinity., Nature 327(6123):591-7


RegulonDB