RegulonDB RegulonDB 10.10:Regulon Page
   

LexA DNA-binding transcriptional repressor

Synonyms: LexA
Summary:
LexA represses the transcription of several genes involved in the cellular response to DNA damage or inhibition of DNA replication [11, 30] as well as its own synthesis [31] This regulation is known as the SOS response [30] which is generated by two related processes; RecF appears to facilitate RecA filament formation on the leading-strand single-stranded DNA gaps generated by replisome lesion skipping [32] When DNA is damaged, the RecA coprotease binds to the single-stranded DNA in the damaged region to form a filament [33, 34] This filament interacts with the LexA dimer to activate its self-cleavage activity by an allosteric mechanism, causing the dissociation of LexA from its DNA targets and the induction of the SOS regulon for the repair of broken DNA [35, 36] Phenylboronic compounds are able to inhibit the self-cleavage of the transcriptional repressor LexA, presumably through the formation of an acyl-enzyme intermediate [37] The conformational flexibility of unbound LexA is the key element in establishing a coordinated SOS response [38] A structurally dynamic peptide loop encoding residues 75-84 of LexA appears to be necessary for the recognition of RecA [39]. LexA is widely distributed in bacteria, and it appears that it emerged from the gram-positive group [40] It shows two domains, the N-terminal domain involved in DNA binding via a helix-turn-helix [41]and the C-terminal domain involved in dimerization and in cleavage activity [42, 43] To repress transcription, LexA blocks the access of RNA polymerase to target promoters [19] LexA dimer [44]recognizes and binds to an imperfect inverted repeat DNA sequence called the LexA box or SOS box [45, 46] Although, the majority of the LexA-regulated genes have only one SOS box, some have two or three boxes which sometimes overlap [1] The crystal structure of the LexA-DNA complex has been determined [47] The DNA-binding domains of the LexA dimer interact with the DNA in the classical fashion of a winged helix-turn-helix (HTH) motif, and they bind to the same minor groove of the DNA [47] lexA is the first gene in the lexA-dinF operon [48] dinF encodes a member of the MATE family of multidrug efflux transporters [49] The SOS system is induced by methylglyoxal (MG), based on ChIP-chip analysis with DNA-RNAP occupancy, and this involves LexA-regulated genes such as recAX, lexA-dinF, and dinB [50] High activity of LexA-regulated genes, also known as the LexA i-modulon [51], was also observed in the wild type and a Glucose Minimal Media Optimized Strain (GMOS) cultivated in the presence of hydrogen peroxide, explaining the extended lag phase observed for these strains upon peroxide treatment [52].
Read more >


Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
LexA Functional   nd nd
Evolutionary Family: LexA
Sensing class: Using internal synthesized signals
Connectivity class: Local Regulator
Gene name: lexA
  Genome position: 4257115-4257723
  Length: 609 bp / 202 aa
Operon name: lexA-dinF
TU(s) encoding the TF:
Transcription unit        Promoter
lexA-dinF
lexAp


Regulon       
Regulated gene(s) cho, ddlB, dinB, dinD, dinF, dinG, dinI, dinJ, dinQ, dnaG, ftsA, ftsI, ftsK, ftsL, ftsQ, ftsW, ftsZ, hokE, insK, lexA, lpxC, mraY, murC, murD, murE, murF, murG, phr, polB, ptrA, recA, recB, recD, recN, recQ, recX, rpoD, rpsU, ruvA, ruvB, sbmC, ssb, sulA, symE, tisB, umuC, umuD, uvrA, uvrB, uvrC, uvrD, uvrY, yafN, yafO, yafP, yafQ, ybfE, ybiB, ydjM, yebG, yehF
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
SOS response (25)
DNA repair (23)
cell division (9)
DNA recombination (9)
murein (peptidoglycan) (8)
Read more >
Regulated operon(s) cho, dinB-yafNOP, dinD, dinG-ybiB, dinI, dinJ-yafQ, dinQ, ftsK, hokE, insK, lexA-dinF, mraZ-rsmH-ftsLI-murEF-mraY-murD-ftsW-murGC-ddlB-ftsQAZ-lpxC, polB, ptrA-recBD, recAX, recN, recQ, rpsU-dnaG-rpoD, ruvAB, sbmC, ssb, sulA, symE, tisB, umuDC, uvrA, uvrB, uvrD, uvrYC, ybfE, ybgA-phr, ydjM, yebG, yehF
First gene in the operon(s) cho, dinB, dinD, dinG, dinI, dinJ, dinQ, ftsK, ftsL, hokE, insK, lexA, phr, polB, ptrA, recA, recN, recQ, rpsU, ruvA, sbmC, ssb, sulA, symE, tisB, umuD, uvrA, uvrB, uvrC, uvrD, uvrY, yafN, ybfE, ydjM, yebG, yehF
Simple and complex regulons ArcA,LexA
CRP,LexA
DinJ-YafQ,LexA
DnaA,LexA
LexA
Read more >
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)
[LexA,-](40)


Transcription factor regulation    


Transcription factor binding sites (TFBSs) arrangements
      

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence LeftPos RightPos Evidence (Confirmed, Strong, Weak) References
  LexA repressor chop Sigma70 -0.5 -23.5 cho
ccgcctgttaCACTGGATAGATAACCAGCAttcggagtca
 1823482 1823501 [AIBSCS], [APIORCISFBSCS] [1], [2]
  LexA repressor dinBp Sigma70 -6.5 -24.5 dinB, yafN, yafO, yafP
accctgaaatCACTGTATACTTTACCAGTGttgagaggtg
 250864 250883 [AIBSCS], [APIORCISFBSCS], [ICWHO] [1], [3]
  LexA repressor dinBp2 Sigma38 -6.5 -24.5 dinB, yafN, yafO, yafP
accctgaaatCACTGTATACTTTACCAGTGttgagaggtg
 250864 250883 [AIBSCS], [APIORCISFBSCS], [ICWHO] [1], [3]
  LexA repressor dinDp nd 8.5 -53.5 dinD
agatactcacAACTGTATATAAATACAGTTacagatttac
 3817697 3817716 [GEA], [AIBSCS], [APIORCISFBSCS] [4]
  LexA repressor dinGp Sigma70 -27.5 -24.5 dinG, ybiB
aatgccacaaTATTGGCTGTTTATACAGTAtttcaggttt
 833036 833055 [GEA], [AIBSCS], [BPP] [5], [6]
  LexA repressor dinIp Sigma70 -7.5 -29.5 dinI
aggttattttACCTGTATAAATAACCAGTAtattcaacag
 1121507 1121526 [GEA], [AIBSCS], [APIORCISFBSCS], [BPP], [IHBCE], [SM] [7], [8]
  LexA repressor dinJp Sigma70 89.5 -24.5 dinJ, yafQ
ctacaattcaAGCTGAATAAATATACAGCAcaggagatac
 246517 246536 [GEA], [AIBSCS] [7], [9]
  LexA repressor dinQp Sigma70 -29.5 -223.5 dinQ
tgcaaggacgTGCTGGTTTTATAACCTGCAtgtactgtat
 3648002 3648021 [APIORCISFBSCS] [10]
  LexA repressor dinQp Sigma70 -7.5 -201.5 dinQ
aacctgcatgTACTGTATGATTATCCAGTTagctctgagg
 3647980 3647999 [GEA], [AIBSCS], [APIORCISFBSCS] [10], [11]
  LexA repressor ftsKp1 Sigma70 -0.5 -86.5 ftsK
ttgattacacTCCTGTTAATCCATACAGCAacagtactgg
 933128 933147 [AIBSCS], [GEA], [AIBSCS], [BPP] [5], [12]
  LexA repressor ftsLp2 nd 3.0 -18.0 ftsL, ftsI, murE, murF, mraY, murD, ftsW, murG, murC, ddlB, ftsQ, ftsA, ftsZ, lpxC
cgtagttcagTTCTGCGTATTGCAGAGAGGacgaatgcat
 91004 91023 [APIORCISFBSCS] [13], [14]
  LexA repressor hokEp Sigma24 -81.5 -186.5 hokE
aaacaggactCACTGTATAAATAAACAGCTattttgttga
 607640 607659 [AIBSCS] [1]
  LexA repressor insKp Sigma24 nd nd insK
nd
 nd nd [GEA], [BPP] [11]
  LexA repressor lexAp Sigma70 -9.0 -37.0 lexA, dinF
aatcgcctttTGCTGTATATACTCACAGCAtaactgtata
 4257068 4257087 [GEA], [APIORCISFBSCS], [BPP], [SM] [15]
  LexA repressor lexAp Sigma70 13.0 -16.0 lexA, dinF
ctcacagcatAACTGTATATACACCCAGGGggcggaatga
 4257089 4257108 [GEA], [APIORCISFBSCS], [BPP], [SM] [15]
  LexA repressor phrp nd -66.5 -152.5 phr
gccagcagctGGCTGCGCTTATCGACAGTTatcgccgtgg
 739345 739364 [APIORCISFBSCS] [7], [16]
  LexA repressor phrp nd 25.5 -61.5 phr
ttatcctgacGCCTGGCTTTCAGGGCAGCGttatttcgaa
 739436 739455 [GEA], [APIORCISFBSCS] [17]
  LexA repressor polBp Sigma70 -40.5 -63.5 polB
gggcagtaatGACTGTATAAAACCACAGCCaatcaaacga
 65834 65853 [GEA], [AIBSCS], [BPP] [5]
  LexA repressor ptrAp Sigma70 20.5 -107.5 ptrA, recB, recD
ccagtcacggACTGATGGTTATATAAACATaggctgactc
 2958982 2959001 [BPP], [SM] [18]
  LexA repressor recAp Sigma70 -20.0 -70.0 recA, recX
aaacacttgaTACTGTATGAGCATACAGTAtaattgcttc
 2823829 2823848 [BPP] [19]
  LexA repressor recNp Sigma70 -22.5 -58.5 recN
ccagcctcttTACTGTATATAAAACCAGTTtatactgtac
 2751727 2751746 [GEA], [AIBSCS], [BPP] [20], [21]
  LexA repressor recNp Sigma70 -0.5 -36.5 recN
aaccagtttaTACTGTACACAATAACAGTAatggtttttc
 2751749 2751768 [GEA], [AIBSCS], [BPP] [20], [21]
  LexA repressor recQp Sigma70 6.0 -23.0 recQ
aaaatagcgcCTGTTTTTATTTCAGGcaatcggggt
 4005834 4005849 [GEA], [APIORCISFBSCS] [22]
  LexA repressor rpsUp3 Sigma70 4.5 -42.5 rpsU, dnaG, rpoD
attttgaaatAAGCTGGCGTTGATGCCAGCggcaaaccga
 3210729 3210748 [BCE], [SM]
  LexA repressor ruvAp1 nd -63.5 -111.5 ruvA, ruvB
aataaattatACTGTGCCATTTTTCAGTTCatcgagacac
 1946078 1946097 [APIORCISFBSCS]
  LexA repressor ruvAp1 nd -12.5 -60.5 ruvA, ruvB
tcttcatcctTCGCTGGATATCTATCCAGCatttttttat
 1946027 1946046 [APIORCISFBSCS], [BPP] [23]
  LexA repressor ruvAp2 nd -72.5 -112.5 ruvA, ruvB
gaataaattaTACTGTGCCATTTTTCAGTTcatcgagaca
 1946079 1946098 [APIORCISFBSCS]
  LexA repressor ruvAp2 nd -19.5 -59.5 ruvA, ruvB
cttcatccttCGCTGGATATCTATCCAGCAtttttttatc
 1946026 1946045 [APIORCISFBSCS], [BPP] [23]
  LexA repressor sbmCp2 nd 17.5 -24.5 sbmC
tttgcaactaTACTGTATATAAAAACAGTAtcaatggagg
 2081277 2081296 [GEA], [IHBCE] [24]
  LexA repressor ssbp3 Sigma70 -46.5 -160.5 ssb
acacaaattgACCTGAATGAATATACAGTAttggaatgca
 4273955 4273974 [APIORCISFBSCS], [BCE]
  LexA repressor sulAp Sigma70 -5.0 -33.0 sulA
tcactggatgTACTGTACATCCATACAGTAactcacaggg
 1020942 1020961 [BCE]
  LexA repressor symEp Sigma70 -8.5 -85.5 symE
tccccatattTACTGATGATATATACAGGTatttagcgcg
 4579916 4579935 [AIBSCS], [BPP] [11]
  LexA repressor tisBp nd -28.0 -244.0 tisB
gtccaaatatTACTGTTTATTTATACAGTAaacttctata
 3853299 3853318 [GEA], [ICA] [11]
  LexA repressor umuDp Sigma70 -20.5 -49.5 umuD, umuC
atcagtattgATCTGCTGGCAAGAACAGACtactgtatat
 1230708 1230727 [APIORCISFBSCS] [7], [25]
  LexA repressor umuDp Sigma70 -0.5 -29.5 umuD, umuC
aagaacagacTACTGTATATAAAAACAGTAtaacttcagg
 1230728 1230747 [BPP] [7], [25]
  LexA repressor uvrAp Sigma70 -28.5 -93.5 uvrA
tgcattccaaTACTGTATATTCATTCAGGTcaatttgtgt
 4273955 4273974 [APIORCISFBSCS], [BCE]
  LexA repressor uvrBp1 Sigma70 -51.5 -84.5 uvrB
tggtgatgaaCTGTTTTTTTATCCAGTataatttgtt
 813434 813450 [GEA], [APIORCISFBSCS], [BPP], [ICA], [SM] [21], [26]
  LexA repressor uvrBp2 Sigma70 -220.5 -284.5 uvrB
tattttttaaCTGGTTAGATAAATGCAatggcagtca
 813234 813250 [GEA], [BPP], [ICA] [21]
  LexA repressor uvrBp2 Sigma70 -167.5 -231.5 uvrB
tgccataaaaCTGTCATCACTCATCTTgacaaatgtt
 813287 813303 [GEA], [BPP], [ICA] [21]
  LexA repressor uvrBp2 Sigma70 -20.5 -84.5 uvrB
tggtgatgaaCTGTTTTTTTATCCAGTataatttgtt
 813434 813450 [BPP], [GEA], [SM], [APIORCISFBSCS], [BPP], [ICA], [SM] [21], [26]
  LexA repressor uvrBp3 Sigma70 -24.5 -398.5 uvrB
tccactattcCTGTGGATAACCATGTGtattagagtt
 813120 813136 [GEA], [BPP], [ICA], [SM] [21]
  LexA repressor uvrCp3 Sigma70 nd nd uvrC
nd
 nd nd [GEA], [BPP] [27]
  LexA repressor uvrDp1 Sigma70 11.0 -66.0 uvrD
taatcagcaaATCTGTATATATACCCAGCTttttggcgga
 3997907 3997926 [APIORCISFBSCS]
  LexA repressor uvrYp2 Sigma70 -129.5 -176.5 uvrY, uvrC
tcgtagggctTACTGTGAAACGATCCGGTAagccgttggt
 1995526 1995545 [GEA], [AIBSCS] [27]
  LexA repressor yafNp Sigma70 -1.5 -37.5 yafN, yafO, yafP
ttatgatgtaTACTATTATGTATATTCTGGtgtgcattat
 251958 251977 [APIORCISFBSCS] [28]
  LexA repressor ybfEp Sigma32 -85.5 -126.5 ybfE
tgattaacgcAACTGATTAAAAACCCAGCGtccgcgtcgc
 712015 712034 [AIBSCS] [1]
  LexA repressor ydjMp Sigma70 -1.5 -42.5 ydjM
cacttccgtgCACTGTATAAAAATCCTATActgtacgtat
 1810159 1810178 [GEA], [AIBSCS], [BPP] [11]
  LexA repressor ydjMp Sigma70 17.5 -24.5 ydjM
aaaaatcctaTACTGTACGTATCGACAGTTtagtgagttt
 1810177 1810196 [GEA], [AIBSCS], [BPP] [11]
  LexA repressor yebGp Sigma70 -9.5 -27.5 yebG
aaaagaaataTACTGTATAAAATCACAGTTattatgagag
 1930765 1930784 [GEA], [AIBSCS], [APIORCISFBSCS], [IHBCE] [29]
  LexA repressor yehFp Sigma70 11.5 -18.5 yehF
catctgcattCAACTGGATAAAATTACAGGgatgcagaat
 2196446 2196465 [AIBSCS] [11]


Alignment and PSSM for LexA TFBSs    

Aligned TFBS of LexA   
  Sequence
  TACTGTTTTTATATACAGTATA
  TACTGTTTATTTATACAGTAAA
  TACTGTTTTTATATACAGTAGT
  AACTGGTTTTATATACAGTAAA
  AACTGTTTTTTTATCCAGTATA
  AACTGTGATTTTATACAGTATA
  TACTGGTTATTTATACAGGTAA
  AACTGTATTTATATACAGTTGT
  CCCTGGGTGTATATACAGTTAT
  TGCTGTGAGTATATACAGCAAA
  TGCTGGTTATCTATCCAGTGTA
  AGCTGTTTATTTATACAGTGAG
  TACTGTTATTGTGTACAGTATA
  CCCTGTAATTTTATCCAGTTGA
  CGCTGGATATCTATCCAGCATT
  TACTGTATGATTATCCAGTTAG
  TGCTGTATATTTATTCAGCTTG
  AGCTGGGTATATATACAGATTT
  TACTGTATGAGCATACAGTATA
  TACTGTACGTATCGACAGTTTA
  TATTGGCTGTTTATACAGTATT
  TACTGTACATCCATACAGTAAC
  TCCTGTTAATCCATACAGCAAC
  TACTGTATATTCATTCAGGTCA
  CACTGGTAAAGTATACAGTGAT
  ACCTGTATATATCATCAGTAAA
  CGCTGGGTTTTTAATCAGTTGC
  GGCTGTGGTTTTATACAGTCAT
  TGCTGGTTTTATAACCTGCATG
  CTCTGGTTTATTGTGCAGTTTA
  TATAGGATTTTTATACAGTGCA
  GGCTGCGCTTATCGACAGTTAT
  TACTGTGAAACGATCCGGTAAG
  TACTGTGCCATTTTTCAGTTCA
  GCCTGTTTTTATTTCAGGCAAT
  CGCTGGCATCAACGCCAGCTTA
  CTATGTTTATATAACCATCAGT
  GCCTGGCTTTCAGGGCAGCGTT
  TTGCATTTATCTAACCAGTTAA
  GTCTGTTCTTGCCAGCAGATCA
  CAAGATGAGTGATGACAGTTTT
  ACACATGGTTATCCACAGGAAT
  ACTATTATGTATATTCTGGTGT
  TCTGCGTATTGCAGAGAGGACG

Position weight matrix (PWM). LexA matrix-quality result    
A	9	20	3	2	3	0	12	10	15	6	16	3	32	6	24	1	40	0	2	20	17	20
C	9	9	36	2	1	1	3	5	1	1	7	6	6	1	11	42	0	0	9	1	5	3
G	5	11	1	2	39	15	11	2	8	0	6	1	3	6	3	1	2	43	5	5	6	6
T	21	4	4	38	1	28	18	27	20	37	15	34	3	31	6	0	2	1	28	18	16	15

Consensus    
;	consensus.strict             	taCTGttttTatataCAGtaaa
;	consensus.strict.rc          	TTTACTGTATATAAAAACAGTA
;	consensus.IUPAC              	trCTGkktwTwtatmCAGtwww
;	consensus.IUPAC.rc           	WWWACTGKATAWAWAMMCAGYA
;	consensus.regexp             	t[ag]CTG[gt][gt]t[at]T[at]tat[ac]CAGt[at][at][at]
;	consensus.regexp.rc          	[AT][AT][AT]ACTG[GT]ATA[AT]A[AT]A[AC][AC]CAG[CT]A

PWM logo   


 


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation


Evidence    

 [AIBSCS] Automated inference based on similarity to consensus sequences

 [APIORCISFBSCS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [ICWHO] Inferred computationally without human oversight

 [GEA] Gene expression analysis

 [BPP] Binding of purified proteins

 [IHBCE] Inferred by a human based on computational evidence

 [SM] Site mutation

 [BCE] Binding of cellular extracts

 [ICA] Inferred by computational analysis


Reference(s)    

 [1] Gillor O., Vriezen JA., Riley MA., 2008, The role of SOS boxes in enteric bacteriocin regulation., Microbiology 154(Pt 6):1783-92

 [2] Kaleta C., Gohler A., Schuster S., Jahreis K., Guthke R., Nikolajewa S., 2010, Integrative inference of gene-regulatory networks in Escherichia coli using information theoretic concepts and sequence analysis., BMC Syst Biol 4:116

 [3] Ohmori H., Hatada E., Qiao Y., Tsuji M., Fukuda R., 1995, dinP, a new gene in Escherichia coli, whose product shows similarities to UmuC and its homologues., Mutat Res 347(1):1-7

 [4] Ohmori H., Saito M., Yasuda T., Nagata T., Fujii T., Wachi M., Nagai K., 1995, The pcsA gene is identical to dinD in Escherichia coli., J Bacteriol 177(1):156-65

 [5] Lewis LK., Jenkins ME., Mount DW., 1992, Isolation of DNA damage-inducible promoters in Escherichia coli: regulation of polB (dinA), dinG, and dinH by LexA repressor., J Bacteriol 174(10):3377-85

 [6] Lewis LK., Mount DW., 1992, Interaction of LexA repressor with the asymmetric dinG operator and complete nucleotide sequence of the gene., J Bacteriol 174(15):5110-6

 [7] Lewis LK., Harlow GR., Gregg-Jolly LA., Mount DW., 1994, Identification of high affinity binding sites for LexA which define new DNA damage-inducible genes in Escherichia coli., J Mol Biol 241(4):507-23

 [8] Yasuda T., Nagata T., Ohmori H., 1996, Multicopy suppressors of the cold-sensitive phenotype of the pcsA68 (dinD68) mutation in Escherichia coli., J Bacteriol 178(13):3854-9

 [9] Ruangprasert A., Maehigashi T., Miles SJ., Giridharan N., Liu JX., Dunham CM., 2014, Mechanisms of toxin inhibition and transcriptional repression by Escherichia coli DinJ-YafQ., J Biol Chem 289(30):20559-69

 [10] Weel-Sneve R., Kristiansen KI., Odsbu I., Dalhus B., Booth J., Rognes T., Skarstad K., Bjoras M., 2013, Single Transmembrane Peptide DinQ Modulates Membrane-Dependent Activities., PLoS Genet 9(2):e1003260

 [11] Fernandez De Henestrosa AR., Ogi T., Aoyagi S., Chafin D., Hayes JJ., Ohmori H., Woodgate R., 2000, Identification of additional genes belonging to the LexA regulon in Escherichia coli., Mol Microbiol 35(6):1560-72

 [12] Dorazi R., Dewar SJ., 2000, The SOS promoter dinH is essential for ftsK transcription during cell division., Microbiology 146 ( Pt 11):2891-9

 [13] Ishino F., Jung HK., Ikeda M., Doi M., Wachi M., Matsuhashi M., 1989, New mutations fts-36, lts-33, and ftsW clustered in the mra region of the Escherichia coli chromosome induce thermosensitive cell growth and division., J Bacteriol 171(10):5523-30

 [14] Vicente M., Gomez MJ., Ayala JA., 1998, Regulation of transcription of cell division genes in the Escherichia coli dcw cluster., Cell Mol Life Sci 54(4):317-24

 [15] Kozuch BC., Shaffer MG., Culyba MJ., 2020, The Parameter-Fitness Landscape of lexA Autoregulation in Escherichia coli., mSphere 5(4)

 [16] Payne NS., Sancar A., 1989, The LexA protein does not bind specifically to the two SOS box-like sequences immediately 5' to the phr gene., Mutat Res 218(3):207-10

 [17] Ma C., Rupert CS., 1995, Promoters of the phr gene in Escherichia coli K-12., Mol Gen Genet 248(1):52-8

 [18] Wade JT., Reppas NB., Church GM., Struhl K., 2005, Genomic analysis of LexA binding reveals the permissive nature of the Escherichia coli genome and identifies unconventional target sites., Genes Dev 19(21):2619-30

 [19] Little JW., Mount DW., Yanisch-Perron CR., 1981, Purified lexA protein is a repressor of the recA and lexA genes., Proc Natl Acad Sci U S A 78(7):4199-203

 [20] Rostas K., Morton SJ., Picksley SM., Lloyd RG., 1987, Nucleotide sequence and LexA regulation of the Escherichia coli recN gene., Nucleic Acids Res 15(13):5041-9

 [21] Wurihan., Gezi., Brambilla E., Wang S., Sun H., Fan L., Shi Y., Sclavi B., Morigen., 2018, DnaA and LexA Proteins Regulate Transcription of the uvrB Gene in Escherichia coli: The Role of DnaA in the Control of the SOS Regulon., Front Microbiol 9:1212

 [22] Irino N., Nakayama K., Nakayama H., 1986, The recQ gene of Escherichia coli K12: primary structure and evidence for SOS regulation., Mol Gen Genet 205(2):298-304

 [23] Shinagawa H., Makino K., Amemura M., Kimura S., Iwasaki H., Nakata A., 1988, Structure and regulation of the Escherichia coli ruv operon involved in DNA repair and recombination., J Bacteriol 170(9):4322-9

 [24] Baquero MR., Bouzon M., Varea J., Moreno F., 1995, sbmC, a stationary-phase induced SOS Escherichia coli gene, whose product protects cells from the DNA replication inhibitor microcin B17., Mol Microbiol 18(2):301-11

 [25] Kitagawa Y., Akaboshi E., Shinagawa H., Horii T., Ogawa H., Kato T., 1985, Structural analysis of the umu operon required for inducible mutagenesis in Escherichia coli., Proc Natl Acad Sci U S A 82(13):4336-40

 [26] Nissenson RA., Strewler GJ., Williams RD., Leung SC., 1985, Activation of the parathyroid hormone receptor-adenylate cyclase system in osteosarcoma cells by a human renal carcinoma factor., Cancer Res 45(11 Pt 1):5358-63

 [27] Stark T., Moses RE., 1989, Interaction of the LexA repressor and the uvrC regulatory region., FEBS Lett 258(1):39-41

 [28] Christensen-Dalsgaard M., Jorgensen MG., Gerdes K., 2010, Three new RelE-homologous mRNA interferases of Escherichia coli differentially induced by environmental stresses., Mol Microbiol 75(2):333-48

 [29] Lomba MR., Vasconcelos AT., Pacheco AB., de Almeida DF., 1997, Identification of yebG as a DNA damage-inducible Escherichia coli gene., FEMS Microbiol Lett 156(1):119-22

 [30] d'Ari R, 1985, The SOS system., Biochimie, 67(3-4):343 10.1016/s0300-9084(85)80077-8

 [31] Brent R, Ptashne M, 1980, The lexA gene product represses its own promoter., Proc Natl Acad Sci U S A, 77(4):1932 10.1073/pnas.77.4.1932

 [32] Myka KK, Marians KJ, 2020, Two components of DNA replication-dependent LexA cleavage., J Biol Chem, 295(30):10368 10.1074/jbc.RA120.014224

 [33] Chen Z., Yang H., Pavletich NP., 2008, Mechanism of homologous recombination from the RecA-ssDNA/dsDNA structures., Nature 453(7194):489-4

 [34] Cox MM, 2007, Regulation of bacterial RecA protein function., Crit Rev Biochem Mol Biol, 42(1):41 10.1080/10409230701260258

 [35] Giese KC, Michalowski CB, Little JW, 2008, RecA-dependent cleavage of LexA dimers., J Mol Biol, 377(1):148 10.1016/j.jmb.2007.12.025

 [36] Little JW., 1991, Mechanism of specific LexA cleavage: autodigestion and the role of RecA coprotease., Biochimie 73(4):411-21

 [37] Bellio P, Mancini A, Di Pietro L, Cracchiolo S, Franceschini N, Reale S, de Angelis F, Perilli M, Amicosante G, Spyrakis F, Tondi D, Cendron L, Celenza G, 2020, Inhibition of the transcriptional repressor LexA: Withstanding drug resistance by inhibiting the bacterial mechanisms of adaptation to antimicrobials., Life Sci, 241(None):117116 10.1016/j.lfs.2019.117116

 [38] Butala M, Klose D, Hodnik V, Rems A, Podlesek Z, Klare JP, Anderluh G, Busby SJ, Steinhoff HJ, Zgur-Bertok D, 2011, Interconversion between bound and free conformations of LexA orchestrates the bacterial SOS response., Nucleic Acids Res, 39(15):6546 10.1093/nar/gkr265

 [39] Hostetler ZM, Cory MB, Jones CM, Petersson EJ, Kohli RM, 2020, The Kinetic and Molecular Basis for the Interaction of LexA and Activated RecA Revealed by a Fluorescent Amino Acid Probe., ACS Chem Biol, 15(5):1127 10.1021/acschembio.9b00886

 [40] Mazón G, Erill I, Campoy S, Cortés P, Forano E, Barbé J, 2004, Reconstruction of the evolutionary history of the LexA-binding sequence., Microbiology (Reading), 150(Pt 11):3783 10.1099/mic.0.27315-0

 [41] Fogh RH., Ottleben G., Ruterjans H., Schnarr M., Boelens R., Kaptein R., 1994, Solution structure of the LexA repressor DNA binding domain determined by 1H NMR spectroscopy., EMBO J 13(17):3936-44

 [42] Luo Y, Pfuetzner RA, Mosimann S, Paetzel M, Frey EA, Cherney M, Kim B, Little JW, Strynadka NC, 2001, Crystal structure of LexA: a conformational switch for regulation of self-cleavage., Cell, 106(5):585 10.1016/s0092-8674(01)00479-2

 [43] Schnarr M, Granger-Schnarr M, Hurstel S, Pouyet J, 1988, The carboxy-terminal domain of the LexA repressor oligomerises essentially as the entire protein., FEBS Lett, 234(1):56 10.1016/0014-5793(88)81302-4

 [44] Mohana-Borges R, Pacheco AB, Sousa FJ, Foguel D, Almeida DF, Silva JL, 2000, LexA repressor forms stable dimers in solution. The role of specific dna in tightening protein-protein interactions., J Biol Chem, 275(7):4708 10.1074/jbc.275.7.4708

 [45] Erill I, Escribano M, Campoy S, Barbé J, 2003, In silico analysis reveals substantial variability in the gene contents of the gamma proteobacteria LexA-regulon., Bioinformatics, 19(17):2225 10.1093/bioinformatics/btg303

 [46] Walker GC, 1984, Mutagenesis and inducible responses to deoxyribonucleic acid damage in Escherichia coli., Microbiol Rev, 48(1):60 10.1128/mr.48.1.60-93.1984

 [47] Zhang AP, Pigli YZ, Rice PA, 2010, Structure of the LexA-DNA complex and implications for SOS box measurement., Nature, 466(7308):883 10.1038/nature09200

 [48] Krueger JH., Elledge SJ., Walker GC., 1983, Isolation and characterization of Tn5 insertion mutations in the lexA gene of Escherichia coli., J Bacteriol 153(3):1368-78

 [49] Brown MH, Paulsen IT, Skurray RA, 1999, The multidrug efflux protein NorM is a prototype of a new family of transporters., Mol Microbiol, 31(1):394 10.1046/j.1365-2958.1999.01162.x

 [50] Ozyamak E., de Almeida C., de Moura AP., Miller S., Booth IR., 2013, Integrated stress response of Escherichia coli to methylglyoxal: transcriptional readthrough from the nemRA operon enhances protection through increased expression of glyoxalase I., Mol Microbiol 88(5):936-50

 [51] Sastry AV, Gao Y, Szubin R, Hefner Y, Xu S, Kim D, Choudhary KS, Yang L, King ZA, Palsson BO, 2019, The Escherichia coli transcriptome mostly consists of independently regulated modules., Nat Commun, 10(1):5536 10.1038/s41467-019-13483-w

 [52] Anand A, Chen K, Catoiu E, Sastry AV, Olson CA, Sandberg TE, Seif Y, Xu S, Szubin R, Yang L, Feist AM, Palsson BO, 2020, OxyR Is a Convergent Target for Mutations Acquired during Adaptation to Oxidative Stress-Prone Metabolic States., Mol Biol Evol, 37(3):660 10.1093/molbev/msz251

 [53] Chen AI, Goulian M, 2018, A network of regulators promotes dehydration tolerance in Escherichia coli., Environ Microbiol, 20(3):1283 10.1111/1462-2920.14074

 [54] Butala M, Zgur-Bertok D, Busby SJ, 2009, The bacterial LexA transcriptional repressor., Cell Mol Life Sci, 66(1):82 10.1007/s00018-008-8378-6


RegulonDB