RegulonDB RegulonDB 10.9:Regulon Page
   

SoxR DNA-binding transcriptional dual regulator

Synonyms: SoxR, SoxR-[2Fe-2S]3+ oxydized, SoxR-[2Fe-2S]2+ reduced
Summary:
The SoxR protein, for "Superoxide Response protein," is negatively autoregulated and controls the transcription of the regulon involved in defense against redox-cycling drugs [4] and in responses to nitric oxide [2, 8]. SoxR belongs to the MerR family and is a homodimer in solution [3]. SoxR contains two essential [2Fe-2S] clusters for its transcriptional activity []. Each SoxR polypeptide contains a [2Fe-2S] cluster that senses the oxidants in the cell. Both Fe-SoxR and apo-SoxR bind to the promoter region, but only Fe-SoxR contributes to the activation in its oxidized form [3]. The redox state of the iron-sulfur cluster regulates SoxR activity [].
Read more >


Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
SoxR Functional   [APPHINH] [1], [2], [3], [4], [5]
SoxR-[2Fe-2S]2+ reduced Non-Functional Covalent Apo [BPP], [IDA], [IPI] [3]
SoxR-[2Fe-2S]3+ oxydized Functional Covalent Holo [BPP], [IDA], [IPI] [3]
Evolutionary Family: MerR
Sensing class: Using internal synthesized signals
Connectivity class: Local Regulator
Gene name: soxR
  Genome position: 4277469-4277933
  Length: 465 bp / 154 aa
Operon name: soxR
TU(s) encoding the TF:
Transcription unit        Promoter
soxR
soxRp


Regulon       
Regulated gene(s) aroF, fumC, sodA, soxR, soxS, tyrA, yjcB, yrbL
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
detoxification (3)
Transcription related (2)
activator (2)
repressor (2)
other (mechanical, nutritional, oxidative stress) (2)
Read more >
Regulated operon(s) aroF-tyrA, fumAC, sodA, soxR, soxS, yjcB, yrbL
First gene in the operon(s) aroF, fumC, sodA, soxR, soxS, yjcB, yrbL
Simple and complex regulons AcrR,FNR,Fur,SoxR
AcrR,FNR,Fur,SoxR,SoxS
ArcA,CRP,FNR,Fur,IHF,MarA,Rob,SoxR,SoxS
ArcA,CRP,FNR,Fur,MarA,SoxR,SoxS
BasR,PhoP,SoxR,SoxS
Read more >
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)
[SoxR,-](1)
[SoxR,+](6)


Transcription factor regulation    


Transcription factor binding sites (TFBSs) arrangements
      

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence LeftPos RightPos Evidence (Confirmed, Strong, Weak) References
  SoxR activator aroFp Sigma70 8.5 -43.5 aroF, tyrA
tatcgttacgTCATCCTCGCTGAGGATCAactatcgcaa
2741185 2741202 [CEEUMA], [IHBCE], [RSE] [6]
  SoxR activator fumCp Sigma38 nd nd fumC nd nd [BPP], [GEA], [IGI] [2]
  SoxR activator sodAp Sigma70 9.0 -43.0 sodA
ataatgaaccAACTGCTTACGCGGCATTAacaatcggcc
4100758 4100775 [CEEUMA], [IHBCE], [RSE] [6]
  SoxR repressor soxRp Sigma70 2.5 -20.5 soxR
gagtataattCCTCAAGTTAACTTGAGGTaaagcgattt
4277440 4277457 [BPP], [CEEUMA], [GEA], [IHBCE], [RSE] [3], [6], [7]
  SoxR activator soxSp Sigma70 -25.5 -65.5 soxS
aaatcgctttACCTCAAGTTAACTTGAGGaattatactc
4277440 4277457 [BPP], [CEEUMA], [GEA], [IHBCE], [RSE] [3], [7]
  SoxR activator soxSp Sigma70 6.0 -35.0 soxS
ttatactcccCAACAGATGAATTAACGAActgaacactg
4277409 4277426 [CEEUMA], [IHBCE], [RSE] [6]
  SoxR activator yjcBp nd -4.0 -127.0 yjcB
tgtgatatagTTCACAAAATTAATGAAACaaacagagtg
4275159 4275176 [CEEUMA], [IHBCE], [RSE] [6]
  SoxR activator yrbLp nd 36.0 5.0 yrbL
tttccaggagATGGCATGATTCGCTTATCtgaacaaagt
3348447 3348464 [AIBSCS], [CEEUMA], [IHBCE], [RSE] [6]


Alignment and PSSM for SoxR TFBSs    

Aligned TFBS of SoxR   
  Sequence
  TACCTCAAGTTAACTTGAGG
  TTCGTTAATTCATCTGTTGG
  TACGTCATCCTCGCTGAGGA
  AATGCCGCGTAAGCAGTTGG
  TTTGTTTCATTAATTTTGTG
  GATGGCATGATTCGCTTATC

Position weight matrix (PWM). SoxR matrix-quality result   
A	1	4	0	0	0	0	4	2	1	1	1	4	2	0	1	0	1	2	0	1
C	0	0	3	1	1	4	0	2	1	1	1	1	1	4	1	0	0	0	0	1
G	1	0	0	5	1	0	1	0	3	0	0	0	2	1	0	3	1	2	4	4
T	4	2	3	0	4	2	1	2	1	4	4	1	1	1	4	3	4	2	2	0

Consensus   
;	consensus.strict             	tacGtCacgttagCtgtgGG
;	consensus.strict.rc          	CCCACAGCTAACGTGACGTA
;	consensus.IUPAC              	twyGtYahgttarCtktdKG
;	consensus.IUPAC.rc           	CMHAMAGYTAACDTRACRWA
;	consensus.regexp             	t[at][ct]Gt[CT]a[act]gtta[ag]Ct[gt]t[agt][GT]G
;	consensus.regexp.rc          	C[AC][ACT]A[AC]AG[CT]TAAC[AGT]T[AG]AC[AG][AT]A

PWM logo   


 


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
Promoter-target gene evolutionary conservation




Reference(s)    

 [1] Amabile-Cuevas CF., Demple B., 1991, Molecular characterization of the soxRS genes of Escherichia coli: two genes control a superoxide stress regulon., Nucleic Acids Res 19(16):4479-84

 [2] Fuentes AM., Diaz-Mejia JJ., Maldonado-Rodriguez R., Amabile-Cuevas CF., 2001, Differential activities of the SoxR protein of Escherichia coli: SoxS is not required for gene activation under iron deprivation., FEMS Microbiol Lett 201(2):271-5

 [3] Hidalgo E., Bollinger JM., Bradley TM., Walsh CT., Demple B., 1995, Binuclear [2Fe-2S] clusters in the Escherichia coli SoxR protein and role of the metal centers in transcription., J Biol Chem 270(36):20908-14

 [4] Nunoshiba T., Hidalgo E., Amabile Cuevas CF., Demple B., 1992, Two-stage control of an oxidative stress regulon: the Escherichia coli SoxR protein triggers redox-inducible expression of the soxS regulatory gene., J Bacteriol 174(19):6054-60

 [5] Wu J., Weiss B., 1991, Two divergently transcribed genes, soxR and soxS, control a superoxide response regulon of Escherichia coli., J Bacteriol 173(9):2864-71

 [6] Seo SW., Kim D., Szubin R., Palsson BO., 2015, Genome-wide Reconstruction of OxyR and SoxRS Transcriptional Regulatory Networks under Oxidative Stress in Escherichia coli K-12 MG1655., Cell Rep 12(8):1289-99

 [7] Hidalgo E., Leautaud V., Demple B., 1998, The redox-regulated SoxR protein acts from a single DNA site as a repressor and an allosteric activator., EMBO J 17(9):2629-36

 [8] Lu C., Bentley WE., Rao G., 2003, Comparisons of oxidative stress response genes in aerobic Escherichia coli fermentations., Biotechnol Bioeng 83(7):864-70

 [9] Nunoshiba T., Hidalgo E., Li Z., Demple B., 1993, Negative autoregulation by the Escherichia coli SoxS protein: a dampening mechanism for the soxRS redox stress response., J Bacteriol 175(22):7492-4

 [10] Pomposiello PJ., Koutsolioutsou A., Carrasco D., Demple B., 2003, SoxRS-regulated expression and genetic analysis of the yggX gene of Escherichia coli., J Bacteriol 185(22):6624-32

 [11] Giro M., Carrillo N., Krapp AR., 2006, Glucose-6-phosphate dehydrogenase and ferredoxin-NADP(H) reductase contribute to damage repair during the soxRS response of Escherichia coli., Microbiology 152(Pt 4):1119-28



RegulonDB