RegulonDB RegulonDB 10.9:Regulon Page
   

MlrA DNA-binding transcriptional activator

Synonyms: MlrA
Summary:
MlrA is a regulator of curli production in an avian pathogenic Escherichia coli strain and in Salmonella enterica serovar Typhimurium [1]. Shiga toxin-encoding prophages have been observed to integrate at the mlrA gene of enterohemorrhagic E. coli []. MlrA is a member of the MerR family, containing the conserved N-terminal DNA-binding domain present in members of this family [1, 2]. On the other hand, its C-terminal domain, probably used by a yet-to-be-identified effector, showed no similarity to any of the hitherto-characterized MerR family members [2]. MlrA binds an AAAGTTGTACA(12N)TGCACAATTTT palindromic sequence and probably induces DNA underwinding, as in the case of MerR [2]. Based on the site identified on the csgDp1 promoter, sites for another four genes were identified, two of which are transcriptional regulators [2].
Read more >


Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
MlrA Functional   [AIFS], [APPHINH], [IEP], [IHBCE] [1], [2], [3], [4]
Evolutionary Family: MerR
Connectivity class: Local Regulator
Gene name: mlrA
  Genome position: 2214866-2215597
  Length: 732 bp / 243 aa
Operon name: mlrA
TU(s) encoding the TF:
Transcription unit        Promoter
mlrA
mlrAp
mlrA
mlrAp2


Regulon       
Regulated gene(s) cadC, csgD, csgE, csgF, csgG, ibaG, obgE, rplU, rpmA, yhbE
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
Transcription related (2)
activator (2)
membrane (2)
translation (2)
ribosomal proteins (2)
Read more >
Regulated operon(s) cadC, csgDEFG, ibaG-murA, rplU-rpmA-yhbE-obgE
First gene in the operon(s) cadC, csgD, ibaG, rplU
Simple and complex regulons BasR,BolA,BtsR,CRP,CpxR,Cra,CsgD,FliZ,H-NS,IHF,MlrA,MqsA,OmpR,RcdA,RcsAB,RstA,ppGpp
BasR,BtsR,CRP,CpxR,Cra,CsgD,FliZ,H-NS,IHF,MlrA,MqsA,OmpR,RcdA,RcsAB,RstA
CadC,FNR,H-NS,LeuO,MlrA,OmpR
DksA-ppGpp,MlrA
MlrA
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)
[MlrA,+](5)


Transcription factor regulation    


Transcription factor binding sites (TFBSs) arrangements
      

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence LeftPos RightPos Evidence (Confirmed, Strong, Weak) References
  MlrA activator cadCp Sigma70 -201.5 -230.5 cadC
aagtgctccgGACAATTTTCCATGGATTATTTTCTGAACATTTTTctttggcaaa
4362148 4362182 [APIORCISFBSCS], [BPP] [2]
  MlrA activator csgDp1 Sigma70 -129.5 -277.5 csgD, csgE, csgF, csgG
tatgatttttTAAAATTGTGCAATAAAAACCAAATGTACAACTTTtctatcattt
1103457 1103491 [BPP], [GEA] [2]
  MlrA activator csgDp3 Sigma38 -129.5 -277.5 csgD, csgE, csgF, csgG
tatgatttttTAAAATTGTGCAATAAAAACCAAATGTACAACTTTtctatcattt
1103457 1103491 [BPP], [GEA] [2]
  MlrA activator ibaGp2 Sigma24 -117.5 -200.5 ibaG
ggggtaaacgACAAAGTGTATACCCTGGCGAAATTGTATAATTTGcctgctgatg
3336987 3337021 [APIORCISFBSCS], [BPP] [2]
  MlrA activator rplUp Sigma70 -85.5 -150.5 rplU, rpmA, yhbE, obgE
attgtactgaAAAAATGGCACAGATAAACGTTACCGTACAAGTTGtgtttttttt
3333585 3333619 [APIORCISFBSCS], [BPP] [2]


Alignment and PSSM for MlrA TFBSs    

Aligned TFBS of MlrA   
  Sequence
  TAGAAAAGTTGTACATTTGGTTTTTATTGCACAATTTT
  AACACAACTTGTACGGTAACGTTTATCTGTGCCATTTT
  CCGGACAATTTTCCATGGATTATTTTCTGAACATTTTT
  CAGGCAAATTATACAATTTCGCCAGGGTATACACTTTG

Position weight matrix (PWM). MlrA matrix-quality result   
A	1	3	0	2	2	3	4	2	0	0	1	0	3	0	3	1	0	1	2	0	0	1	0	1	1	1	0	0	1	1	3	0	3	2	0	0	0	0
C	2	1	1	0	2	1	0	1	0	0	0	0	1	4	0	0	0	0	0	2	0	1	1	0	0	0	2	0	0	1	0	4	1	1	0	0	0	0
G	0	0	3	2	0	0	0	1	0	0	2	0	0	0	1	1	1	1	1	1	2	0	0	0	1	1	1	0	3	0	1	0	0	0	0	0	0	1
T	1	0	0	0	0	0	0	0	4	4	1	4	0	0	0	2	3	2	1	1	2	2	3	3	2	2	1	4	0	2	0	0	0	1	4	4	4	3

Consensus   
;	consensus.strict             	caGgcaAaTTgTaCatttacgtttttcTGtaCaaTTTt
;	consensus.strict.rc          	AAAATTGTACAGAAAAACGTAAATGTACAATTTGCCTG
;	consensus.IUPAC              	cmSrmmAvTTgTmCrkkkrskyytkksTGyrCmmTTTk
;	consensus.IUPAC.rc           	MAAAKKGYRCASMMARRMSYMMMYGKACAABTKKYSKG
;	consensus.regexp             	c[ac][CG][ag][ac][ac]A[acg]TTgT[ac]C[ag][gt][gt][gt][ag][cg][gt][ct][ct]t[gt][gt][cg]TG[ct][ag]C[ac][ac]TTT[gt]
;	consensus.regexp.rc          	[AC]AAA[GT][GT]G[CT][AG]CA[CG][AC][AC]A[AG][AG][AC][CG][CT][AC][AC][AC][CT]G[GT]ACAA[CGT]T[GT][GT][CT][CG][GT]G

PWM logo   


 


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation






RegulonDB