RegulonDB RegulonDB 10.9:Regulon Page
   

MntR DNA-binding transcriptional dual regulator

Synonyms: MntR-Cd2+, MntR, MntR-Mn2+
Summary:
MntR, "Mn2+ transport regulator", the primary sensor and transducer of manganese abundance, is a dual regulator that senses manganese and negatively or positively controls the transcription of different genes involved in manganese homeostasis [1, 2] This protein belongs to the DtxR family. The members of this family have three domains: an N-terminal domain with a helix-turn-helix motif, which binds to DNA; a central domain for dimerization and metal ion binding; and a C-terminal alpha-spectrin SH3-like domain. However, MntR lacks the SH3-like domain [1] The 3D structure of apo-MntR has been solved. The protein dimerizes via its C-terminal domain. The N-terminal and C-terminal domains are connected by a long α-helical linker [] The N-terminal domain is expected to bind two manganese ions per monomer, in analogy to BsMntR from B. subtilis, which has been crystallized with and without bound manganese [] All residues involved in manganese binding in BsMntR ar conserved in MntR [] MntR does not seem to be autoregulated [1] Many iron acquisition genes are derepressed in the mntR mutant [2] Read more >


Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
MntR Non-Functional   Apo [HIFS], [IEP], [IHBCE], [IPI] [1], [2]
MntR-Cd2+ Functional Allosteric Holo nd nd
MntR-Mn2+ Functional Allosteric Holo nd nd
Connectivity class: Local Regulator
Gene name: mntR
  Genome position: 853183-853650
  Length: 468 bp / 155 aa
Operon name: mntR-ybiR
TU(s) encoding the TF:
Transcription unit        Promoter
mntR-ybiR
mntRp


Regulon       
Regulated gene(s) dps, mntH, mntP, mntS, rybA
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
membrane (2)
incorporation of metal ions (1)
nucleoproteins, basic proteins (1)
starvation (1)
Porters (Uni-, Sym- and Antiporters) (1)
Read more >
Regulated operon(s) dps, mntH, mntP, rybA-mntS
First gene in the operon(s) dps, mntH, mntP, mntS
Simple and complex regulons Fis,H-NS,IHF,MntR,OxyR
Fur,MntR
Fur,MntR,OxyR
MntR
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)
[MntR,+](1)
[MntR,-](4)


Transcription factor regulation    


Transcription factor binding sites (TFBSs) arrangements
      

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence LeftPos RightPos Evidence (Confirmed, Strong, Weak) References
  MntR repressor dpsp Sigma70 -17.5 -56.5 dps
agaatagcggAACACATAGCCGGTGCTATACTTaatctcgtta
848957 848978 [APIORCISFBSCS], [GEA] [3]
  MntR repressor dpsp2 Sigma38 -17.5 -56.5 dps
agaatagcggAACACATAGCCGGTGCTATACTTaatctcgtta
848957 848978 [APIORCISFBSCS], [GEA] [3]
  MntR repressor mntHp Sigma70 5.5 -23.5 mntH
ggcatagcatGAAACATAGCAAAGGCTATGTTTtagaggcaca
2512719 2512740 [AIBSCS], [BPP], [GEA] [1], [4]
  MntR activator mntPp Sigma70 -183.5 -412.5 mntP
aataagttatGAATTTAGCCAAAGCTATGTTTAgtgtattttt
1905265 1905286 [APIORCISFBSCS], [GEA] [2]
  MntR activator mntPp Sigma70 -143.5 -372.5 mntP
tttaataatcAGACATAGCTTAGGCTATATTACctcttccctt
1905305 1905326 [APIORCISFBSCS], [GEA] [2]
  MntR repressor rybAp Sigma70 -19.5 -86.5 mntS, rybA
caaaaaattaACGTTTTAGCAATAGCTATATAAtatagcctgt
853073 853094 [APIORCISFBSCS], [GEA] [2]
  MntR repressor rybAp Sigma70 -0.5 -67.5 mntS, rybA
caatagctatATAATATAGCCTGTGCTATATCTgtatgtaatg
853054 853075 [APIORCISFBSCS], [GEA] [2]


Alignment and PSSM for MntR TFBSs    

Aligned TFBS of MntR   
  Sequence
  GATATAGCACAGGCTATATTATATA
  AACATAGCAAAGGCTATGTTTTAGA
  AATTTAGCCAAAGCTATGTTTAGTG
  AATATAGCCTAAGCTATGTCTGATT
  AGTATAGCACCGGCTATGTGTTCCG
  GTTTTAGCAATAGCTATATAATATA

Position weight matrix (PWM). MntR matrix-quality result   
A	4	4	0	4	0	6	0	0	4	3	4	3	0	0	0	6	0	2	0	1	2	1	4	0	3
C	0	0	1	0	0	0	0	6	2	2	1	0	0	6	0	0	0	0	0	1	0	0	1	1	0
G	2	1	0	0	0	0	6	0	0	0	0	3	6	0	0	0	0	4	0	1	0	1	1	1	2
T	0	1	5	2	6	0	0	0	0	1	1	0	0	0	6	0	6	0	6	3	4	4	0	4	1

Consensus   
;	consensus.strict             	aataTAGCaaagGCTATGTtttata
;	consensus.strict.rc          	TATAAAACATAGCCTTTGCTATATT
;	consensus.IUPAC              	ratwTAGCmmarGCTATRTtwtatr
;	consensus.IUPAC.rc           	YATAWAAYATAGCYTKKGCTAWATY
;	consensus.regexp             	[ag]at[at]TAGC[ac][ac]a[ag]GCTAT[AG]Tt[at]tat[ag]
;	consensus.regexp.rc          	[CT]ATA[AT]AA[CT]ATAGC[CT]T[GT][GT]GCTA[AT]AT[CT]

PWM logo   


 


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation






RegulonDB