RegulonDB RegulonDB 10.9:Regulon Page
   

NtrC DNA-binding transcriptional dual regulator

Synonyms: NtrC-Pasp


Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
NtrC-Pasp Functional Covalent Holo [APPHINH], [HIFS] [1], [2], [3], [4]
Sensing class: External-Two-component systems
Connectivity class: Local Regulator
Gene name: glnG
  Genome position: 4053869-4055278
  Length: 1410 bp / 469 aa
Operon name: glnALG
TU(s) encoding the TF:
Transcription unit        Promoter
glnALG
glnAp1
glnALG
glnAp2
glnLG
glnLp


Regulon       
Regulated gene(s) amtB, argT, astA, astB, astC, astD, astE, cbl, ddpA, ddpB, ddpC, ddpD, ddpF, ddpX, glnA, glnG, glnH, glnK, glnL, glnP, glnQ, hisJ, hisM, hisP, hisQ, nac, patA, potF, potG, potH, potI, relA, rpoE, rseA, rseB, rseC, rseD, rutA, rutB, rutC, rutD, rutE, rutF, rutG, yeaG, yeaH, yhdW, yhdX, yhdY, yhdZ
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
membrane (12)
nitrogen metabolism (11)
ABC superfamily, membrane component (9)
other (mechanical, nutritional, oxidative stress) (8)
Transcription related (7)
Read more >
Regulated operon(s) argT-hisJQMP, astCADBE, cbl, ddpXABCDF, glnALG, glnHPQ, glnK-amtB, nac, patA, potFGHI, relA-mazEFG, rseD-rpoE-rseABC, rutABCDEFG, yeaGH, yhdWXYZ
First gene in the operon(s) argT, astC, cbl, ddpX, glnA, glnH, glnK, glnL, nac, patA, potF, relA, rseD, rutA, yeaG, yhdW
Simple and complex regulons ArcA,NtrC,PhoP,RutR
ArgR,NtrC
CRP,Fis,NtrC
CRP,GlrR,NtrC,RcsB
CRP,NtrC
Read more >
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)
[NtrC,-](3)
[NtrC,+](17)


Transcription factor regulation    


Transcription factor binding sites (TFBSs) arrangements
      

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence LeftPos RightPos Evidence (Confirmed, Strong, Weak) References
  NtrC-Pasp activator argTp Sigma54 -190.0 -248.0 argT, hisJ, hisQ, hisM, hisP
aactccgctgTTGCCCTGTTTCAGGGCAattttgcaac
2428031 2428047 [AIBSCS], [GEA] [5]
  NtrC-Pasp activator argTp Sigma54 -83.0 -141.0 argT, hisJ, hisQ, hisM, hisP
ctatcttcaaCTTCAGGACAATAATGCAacgtcttatt
2427924 2427940 [AIBSCS], [GEA] [5]
  NtrC-Pasp activator astCp2 Sigma54 -275.0 -337.0 astC, astA, astD, astB, astE
ggttgttaatGATGTCAACGATGGCGCAaaaaatgccc
1832311 1832327 [AIBSCS], [BPP], [GEA] [6]
  NtrC-Pasp activator astCp2 Sigma54 -253.0 -315.0 astC, astA, astD, astB, astE
ggcgcaaaaaATGCCCGCTTTTGGTGCGcgctgcgtca
1832289 1832305 [AIBSCS], [BPP], [GEA] [6]
  NtrC-Pasp activator astCp2 Sigma54 -233.0 -295.0 astC, astA, astD, astB, astE
ttggtgcgcgCTGCGTCAGAATGGCGCAgtaatttcca
1832269 1832285 [AIBSCS], [BPP], [GEA] [6]
  NtrC-Pasp activator cblp Sigma70 nd nd cbl nd nd [BPP], [GEA], [IGI] [5]
  NtrC-Pasp activator ddpXp Sigma54 -109.0 -140.0 ddpX, ddpA, ddpB, ddpC, ddpD, ddpF
acttcccctcTTGCACCAAAACTGCACTacgctgcaca
1563208 1563224 [AIBSCS], [GEA] [5]
  NtrC-Pasp activator ddpXp Sigma54 -88.0 -119.0 ddpX, ddpA, ddpB, ddpC, ddpD, ddpF
ctgcactacgCTGCACAAATGTTGATCAaaagttaaaa
1563187 1563203 [AIBSCS], [GEA] [5]
  NtrC-Pasp repressor glnAp1 Sigma70 -25.0 -213.0 glnA, glnL, glnG
ccaaaggtcaTTGCACCAACATGGTGCTtaatgtttcc
4058239 4058255 [APIORCISFBSCS], [BPP], [GEA], [SM] [7]
  NtrC-Pasp repressor glnAp1 Sigma70 8.0 -181.0 glnA, glnL, glnG
gtttccattgAAGCACTATATTGGTGCAacattcacat
4058207 4058223 [APIORCISFBSCS], [BPP], [GEA], [SM] [7]
  NtrC-Pasp repressor glnAp1 Sigma70 27.0 -162.0 glnA, glnL, glnG
attggtgcaaCATTCACATCGTGGTGCAgcccttttgc
4058188 4058204 [APIORCISFBSCS], [BPP], [GEA], [SM] [7]
  NtrC-Pasp repressor glnAp1 Sigma70 48.0 -141.0 glnA, glnL, glnG
tggtgcagccCTTTTGCACGATGGTGCGcatgataacg
4058167 4058183 [APIORCISFBSCS], [GEA], [SM] [7]
  NtrC-Pasp repressor glnAp1 Sigma70 71.0 -118.0 glnA, glnL, glnG
gtgcgcatgaTAACGCCTTTTAGGGGCAatttaaaagt
4058144 4058160 [APIORCISFBSCS], [GEA] [7]
  NtrC-Pasp activator glnAp2 Sigma54 -140.0 -213.0 glnA, glnL, glnG
ccaaaggtcaTTGCACCAACATGGTGCTtaatgtttcc
4058239 4058255 [APIORCISFBSCS], [BPP], [GEA], [SM] [2], [8], [9]
  NtrC-Pasp activator glnAp2 Sigma54 -108.0 -181.0 glnA, glnL, glnG
gtttccattgAAGCACTATATTGGTGCAacattcacat
4058207 4058223 [APIORCISFBSCS], [BPP], [GEA], [SM] [2], [9], [10]
  NtrC-Pasp activator glnAp2 Sigma54 -89.0 -162.0 glnA, glnL, glnG
attggtgcaaCATTCACATCGTGGTGCAgcccttttgc
4058188 4058204 [APIORCISFBSCS], [BPP], [GEA], [SM] [2], [8], [9]
  NtrC-Pasp activator glnAp2 Sigma54 -68.0 -141.0 glnA, glnL, glnG
tggtgcagccCTTTTGCACGATGGTGCGcatgataacg
4058167 4058183 [APIORCISFBSCS], [GEA], [SM] [11]
  NtrC-Pasp activator glnAp2 Sigma54 -45.0 -118.0 glnA, glnL, glnG
gtgcgcatgaTAACGCCTTTTAGGGGCAatttaaaagt
4058144 4058160 [APIORCISFBSCS], [GEA] [11]
  NtrC-Pasp repressor glnHp2 Sigma54 -135.0 -178.0 glnH, glnP, glnQ
actgtgttgaGTGCACAATTTTAGCGCAccagattggt
848174 848190 [APIORCISFBSCS], [BPP] [12]
  NtrC-Pasp activator glnHp2 Sigma54 -122.0 -165.0 glnH, glnP, glnQ
cacaattttaGCGCACCAGATTGGTGCCccagaatggt
848161 848177 [APIORCISFBSCS], [BPP] [12]
  NtrC-Pasp activator glnHp2 Sigma54 -109.0 -152.0 glnH, glnP, glnQ
caccagattgGTGCCCCAGAATGGTGCAtcttcagggt
848148 848164 [APIORCISFBSCS], [BPP] [12]
  NtrC-Pasp repressor glnHp2 Sigma54 -79.0 -122.0 glnH, glnP, glnQ
ttcagggtatTGCCCTATAAATCGTGCAtcacgttttt
848118 848134 [APIORCISFBSCS], [BPP] [12]
  NtrC-Pasp activator glnKp Sigma54 -87.0 -129.0 glnK, amtB
taacgcactgTGCACTGTCATAGTGCGTtttcattttc
472461 472477 [APIORCISFBSCS] [13]
  NtrC-Pasp repressor glnLp Sigma70 3.0 -30.0 glnL, glnG
aaaagctataATGCACTAAAATGGTGCAacctgttcag
4056361 4056377 [APIORCISFBSCS], [BPP], [SM] [4]
  NtrC-Pasp activator nacp Sigma54 -152.0 -197.0 nac
ttattgggtaATGAACCATCGTGGTGCAtaccctcctt
2062122 2062138 [APIORCISFBSCS] [14]
  NtrC-Pasp activator patAp Sigma38 -543.0 -579.0 patA
atccgggtgaCGCACCATGTTGTGCGGCtgcccttgta
3218907 3218924 [AIBSCS], [IEP] [15]
  NtrC-Pasp activator patAp Sigma38 -193.0 -229.0 patA
ttaattatctTGCCCAAAAATCAGGCAAttattgccct
3219257 3219273 [AIBSCS], [GEA] [16], [17]
  NtrC-Pasp activator patAp Sigma38 -171.0 -207.0 patA
aggcaattatTGCCCTGAAAACGTGCATttgcgcagca
3219279 3219295 [AIBSCS], [GEA] [16], [17]
  NtrC-Pasp activator patAp2 Sigma54 -543.0 -579.0 patA
atccgggtgaCGCACCATGTTGTGCGGCtgcccttgta
3218907 3218924 [AIBSCS], [IEP] [15]
  NtrC-Pasp activator patAp2 Sigma54 -193.0 -229.0 patA
ttaattatctTGCCCAAAAATCAGGCAAttattgccct
3219257 3219273 [AIBSCS], [GEA] [16], [17]
  NtrC-Pasp activator patAp2 Sigma54 -171.0 -207.0 patA
aggcaattatTGCCCTGAAAACGTGCATttgcgcagca
3219279 3219295 [AIBSCS], [GEA] [16], [17]
  NtrC-Pasp activator potFp1 Sigma54 nd nd potF, potG, potH, potI nd nd [BPP], [GEA], [IGI] [5]
  NtrC-Pasp activator relAp4 Sigma54 nd nd relA nd nd [BPP], [GEA], [IGI] [18]
  NtrC-Pasp activator rpoEp2b Sigma70 -33.5 -208.5 rseD, rpoE, rseA, rseB, rseC
tttggtcagcATAGCATCATGTTGTGCGGataaacacct
2710364 2710382 [APIORCISFBSCS], [BPP] [19]
  NtrC-Pasp activator rseDp Sigma54 -33.5 -208.5 rseD, rpoE, rseA, rseB, rseC
tttggtcagcATAGCATCATGTTGTGCGGataaacacct
2710364 2710382 [APIORCISFBSCS], [BPP] [19]
  NtrC-Pasp activator rutAp Sigma54 -145.0 -160.0 rutA, rutB, rutC, rutD, rutE, rutF, rutG
cctcgaccttCTGCACTCTCATCGCGCAcagatgcatg
1074163 1074179 [AIBSCS], [GEA] [5]
  NtrC-Pasp activator rutAp Sigma54 -124.0 -139.0 rutA, rutB, rutC, rutD, rutE, rutF, rutG
tcgcgcacagATGCATGTTTTATGTGCAactgttttga
1074142 1074158 [AIBSCS], [GEA] [5]
  NtrC-Pasp activator yeaGp1 Sigma54 nd nd yeaG, yeaH nd nd [BPP], [GEA], [IGI] [5]
  NtrC-Pasp activator yhdWp Sigma54 -126.0 -196.0 yhdW, yhdX, yhdY, yhdZ
gtaaatatttTGCGCCAAAATGTGGCGCatgtttcatt
3418838 3418854 [AIBSCS], [GEA] [5]
  NtrC-Pasp activator yhdWp Sigma54 -96.0 -166.0 yhdW, yhdX, yhdY, yhdZ
gtttcattttCGCACCATTGCGGGGCGCtgtttttatt
3418868 3418884 [AIBSCS], [GEA] [5]


Alignment and PSSM for NtrC TFBSs    

Aligned TFBS of NtrC   
  Sequence
  GATGCACCATTCTGGGGCAC
  TAAGCACCATGTTGGTGCAA
  GTTGCACCATTTTAGTGCAT
  TTCGCACCATTGCGGGGCGC
  AGTGCACAATTTTAGCGCAC
  AATGCACGTTTTCAGGGCAA
  ATTGCCTGATTTTTGGGCAA
  GAAGCACTATATTGGTGCAA
  AATGCCCGCTTTTGGTGCGC
  GTTGCCCTGTTTCAGGGCAA
  TGCGCCACATTTTGGCGCAA
  GGGGCACCAATCTGGTGCGC
  GATGCATGTTTTATGTGCAA
  AACGCACTATGACAGTGCAC
  AATGAACCATCGTGGTGCAT
  GACGCACCATGTTGTGCGGC
  ACTGCGCCATTCTGACGCAG
  ATAACGCCTTTTAGGGGCAA
  GTAGTGCAGTTTTGGTGCAA
  TGTGCGCGATGAGAGTGCAG
  GATGCACGATTTATAGGGCA
  TTTGCACGATGGTGCGCATG
  ATAGCATCATGTTGTGCGGA
  GTTGCATTATTGTCCTGAAG
  GCTGCACAAATGTTGATCAA
  TTTGCGCCATCGTTGACATC
  TTCACATCGTGGTGCAGCCC

Position weight matrix (PWM). NtrC matrix-quality result   
A	9	10	5	2	1	18	1	3	20	2	1	2	3	6	2	3	0	3	18	12
C	0	2	5	0	25	4	21	13	1	0	2	3	4	1	3	3	4	21	2	9
G	11	4	1	25	0	5	0	7	3	0	7	7	1	15	20	10	22	3	5	4
T	7	11	16	0	1	0	5	4	3	25	17	15	19	5	2	11	1	0	2	2

Consensus   
;	consensus.strict             	gttGCaCcaTtttgGgGCac
;	consensus.strict.rc          	GTGCCCCAAAATGGTGCAAC
;	consensus.IUPAC              	rwtGCaCsaTkktgGkGCam
;	consensus.IUPAC.rc           	KTGCMCCAMMATSGTGCAWY
;	consensus.regexp             	[ag][at]tGCaC[cg]aT[gt][gt]tgG[gt]GCa[ac]
;	consensus.regexp.rc          	[GT]TGC[AC]CCA[AC][AC]AT[CG]GTGCA[AT][CT]

PWM logo   


 


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation




Reference(s)    

 [1] Miranda-Rios J., Sanchez-Pescador R., Urdea M., Covarrubias AA., 1987, The complete nucleotide sequence of the glnALG operon of Escherichia coli K12., Nucleic Acids Res 15(6):2757-70

 [2] Ninfa AJ., Reitzer LJ., Magasanik B., 1987, Initiation of transcription at the bacterial glnAp2 promoter by purified E. coli components is facilitated by enhancers., Cell 50(7):1039-46

 [3] Reitzer L., 2003, Nitrogen assimilation and global regulation in Escherichia coli., Annu Rev Microbiol 57:155-76

 [4] Ueno-Nishio S., Mango S., Reitzer LJ., Magasanik B., 1984, Identification and regulation of the glnL operator-promoter of the complex glnALG operon of Escherichia coli., J Bacteriol 160(1):379-84

 [5] Zimmer DP., Soupene E., Lee HL., Wendisch VF., Khodursky AB., Peter BJ., Bender RA., Kustu S., 2000, Nitrogen regulatory protein C-controlled genes of Escherichia coli: scavenging as a defense against nitrogen limitation., Proc Natl Acad Sci U S A 97(26):14674-9

 [6] Kiupakis AK., Reitzer L., 2002, ArgR-independent induction and ArgR-dependent superinduction of the astCADBE operon in Escherichia coli., J Bacteriol 184(11):2940-50

 [7] Reitzer LJ., Magasanik B., 1985, Expression of glnA in Escherichia coli is regulated at tandem promoters., Proc Natl Acad Sci U S A 82(7):1979-83

 [8] Collado-Vides J., Magasanik B., Gralla JD., 1991, Control site location and transcriptional regulation in Escherichia coli., Microbiol Rev 55(3):371-94

 [9] Reitzer LJ., Movsas B., Magasanik B., 1989, Activation of glnA transcription by nitrogen regulator I (NRI)-phosphate in Escherichia coli: evidence for a long-range physical interaction between NRI-phosphate and RNA polymerase., J Bacteriol 171(10):5512-22

 [10] Reitzer LJ., Magasanik B., 1986, Transcription of glnA in E. coli is stimulated by activator bound to sites far from the promoter., Cell 45(6):785-92

 [11] Atkinson MR., Pattaramanon N., Ninfa AJ., 2002, Governor of the glnAp2 promoter of Escherichia coli., Mol Microbiol 46(5):1247-57

 [12] Claverie-Martin F., Magasanik B., 1991, Role of integration host factor in the regulation of the glnHp2 promoter of Escherichia coli., Proc Natl Acad Sci U S A 88(5):1631-5

 [13] van Heeswijk WC., Hoving S., Molenaar D., Stegeman B., Kahn D., Westerhoff HV., 1996, An alternative PII protein in the regulation of glutamine synthetase in Escherichia coli., Mol Microbiol 21(1):133-46

 [14] Muse WB., Bender RA., 1998, The nac (nitrogen assimilation control) gene from Escherichia coli., J Bacteriol 180(5):1166-73

 [15] Robison K., McGuire AM., Church GM., 1998, A comprehensive library of DNA-binding site matrices for 55 proteins applied to the complete Escherichia coli K-12 genome., J Mol Biol 284(2):241-54

 [16] Samsonova NN., Smirnov SV., Altman IB., Ptitsyn LR., 2003, Molecular cloning and characterization of Escherichia coli K12 ygjG gene., BMC Microbiol 3(1):2

 [17] Schneider BL., Hernandez VJ., Reitzer L., 2013, Putrescine catabolism is a metabolic response to several stresses in Escherichia coli., Mol Microbiol 88(3):537-50

 [18] Brown DR., Barton G., Pan Z., Buck M., Wigneshweraraj S., 2014, Nitrogen stress response and stringent response are coupled in Escherichia coli., Nat Commun 5:4115

 [19] Klein G., Stupak A., Biernacka D., Wojtkiewicz P., Lindner B., Raina S., 2016, Multiple Transcriptional Factors Regulate Transcription of the rpoE Gene in Escherichia coli under Different Growth Conditions and When the Lipopolysaccharide Biosynthesis Is Defective., J Biol Chem 291(44):22999-23019



RegulonDB