RegulonDB RegulonDB 11.0:Regulon Page
   

OmpR DNA-binding transcriptional dual regulator

Synonyms: OmpR-phosphorylated, OmpR


Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
OmpR Functional   Apo nd nd
OmpR-phosphorylated Functional Covalent Holo nd nd
TFBs length: 20
TFBs symmetry: direct-repeat
Sensing class: External-Two-component systems
Connectivity class: Local Regulator
Gene name: ompR
  Genome position: 3535865-3536584
  Length: 720 bp / 239 aa
Operon name: ompR-envZ
TU(s) encoding the TF:
Transcription unit        Promoter
ompR-envZ
ompRp1
ompR-envZ
ompRp2
ompR-envZ
ompRp3
ompR-envZ
ompRp4


Regulon       
Regulated gene(s) bolA, cadA, cadB, cadC, csgD, csgE, csgF, csgG, dtpA, ecnB, fadL, feoA, feoB, feoC, flhC, flhD, micF, nmpC, ompC, ompF, omrA, omrB, pgaA, pgaB, pgaC, pgaD, sra
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
Transcription related (5)
activator (5)
repressor (4)
membrane (4)
Beta barrel porins (The Outer Membrane Porin (OMP) Functional Superfamily) (4)
Read more >
Regulated operon(s) bdm-sra, bolA, cadBA, cadC, csgDEFG, dtpA, ecnAB, fadL, feoABC, flhDC, micF, nmpC, ompC, ompF, omrA, omrB, pgaABCD
First gene in the operon(s) bolA, cadB, cadC, csgD, ecnB, fadL, feoA, flhD, micF, ompC, ompF, omrA, omrB, pgaA, sra, dtpA
Simple and complex regulons AcrR,CRP,FliZ,Fur,H-NS,HdfR,IHF,LrhA,MatA,OmpR,QseB,RcsAB,YjjQ
AcrR,H-NS,HU,IHF,Lrp,MarA,OmpR,Rob,SoxS
ArcA,CRP,FadR,OmpR,PhoP,Rob,ppGpp
ArcA,CadC,GadE-RcsB,GadX,H-NS,Lrp,OmpR
BasR,BolA,BtsR,CRP,CpxR,Cra,CsgD,FliZ,H-NS,IHF,MlrA,MqsA,OmpR,RcdA,RcsAB,RstA,ppGpp
Read more >
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)
[OmpR,-](12)
[OmpR,+](11)


Transcription factor regulation    


Transcription factor binding sites (TFBSs) arrangements
      

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence
LeftPos RightPos Growth Conditions Evidence (Confirmed, Strong, Weak) References
  OmpR-phosphorylated repressor bolAp Sigma38 -47.5 -85.5 bolA
aggacgaaacCTAAATATTTGTTGTTAAGCtgcaatggaa
454377 454396 nd [APIORCISFBSCS], [BPP] [1]
  OmpR-phosphorylated repressor bolAp1 Sigma70 -47.5 -85.5 bolA
aggacgaaacCTAAATATTTGTTGTTAAGCtgcaatggaa
454377 454396 nd [APIORCISFBSCS], [BPP] [1]
  OmpR repressor cadBp Sigma70 nd nd cadB, cadA nd nd nd [GEA], [BPP] [2]
  OmpR repressor cadCp Sigma70 nd nd cadC nd nd nd [GEA], [BPP] [2]
  OmpR-phosphorylated activator csgDp1 Sigma70 -49.5 -197.5 csgD, csgE, csgF, csgG
aatataacgaGTTACATTTAGTTACATGTTtaacacttga
1103384 1103403 nd [GEA], [APIORCISFBSCS], [BPP] [3], [4], [5]
  OmpR-phosphorylated activator csgDp3 Sigma38 -49.5 -197.5 csgD, csgE, csgF, csgG
aatataacgaGTTACATTTAGTTACATGTTtaacacttga
1103384 1103403 nd [GEA], [APIORCISFBSCS], [BPP] [3], [4], [5]
  OmpR-phosphorylated repressor ecnBp Sigma38 18.5 -26.5 ecnB
tttgctatagGCAAACATAAATAACATTACctaaaaggaa
4376517 4376536 nd [APIORCISFBSCS] [6]
  OmpR-phosphorylated repressor fadLp Sigma38 -149.5 -250.5 fadL
gataagtgacCGAAATCACACTTAAAAATGatctaaaaca
2461046 2461065 nd [APIORCISFBSCS], [SM]
  OmpR-phosphorylated repressor fadLp Sigma38 -60.5 -161.5 fadL
atcgcgtttcTTAGATCATATTTGAAAAAAgatagaaaca
2461135 2461154 nd [GEA], [APIORCISFBSCS] [7]
  OmpR-phosphorylated repressor fadLp Sigma38 69.5 -32.5 fadL
gttacagcacGTAACATAGTTTGTATAAAAataaatcatt
2461264 2461283 nd [GEA], [APIORCISFBSCS] [7]
  OmpR-phosphorylated repressor fadLp Sigma38 119.5 18.5 fadL
tcatgagccaGAAAACCCTGTTTACAAAGTctgctctcgc
2461314 2461333 nd [GEA], [APIORCISFBSCS] [7]
  OmpR-phosphorylated activator feoAp Sigma70 -178.0 -284.0 feoA, feoB, feoC
ccggcaatatTTATCATTTCATTAACAACTgaaaccttaa
3539869 3539888 nd [GEA], [APIORCISFBSCS], [BPP], [SM] [8]
  OmpR-phosphorylated repressor flhDp Sigma70 -145.5 -343.5 flhD, flhC
caaagtcatcGGGCATTATCTGAACATAAAacactatcaa
1978531 1978550 nd [APIORCISFBSCS]
  OmpR-phosphorylated repressor flhDp Sigma70 18.5 -180.5 flhD, flhC
tcgatttaggAAAAATCTTAGATAAGTGTAaagacccatt
1978368 1978387 nd [APIORCISFBSCS]
  OmpR-phosphorylated activator micFp1 Sigma70 -206.5 -206.5 micF
atccaacacgAATATGATACTAAAACTTTTaagatgtttc
2312868 2312887 nd [GEA], [APIORCISFBSCS], [BPP], [SM] [9], [10], [11], [12], [13]
  OmpR-phosphorylated activator micFp1 Sigma70 -186.5 -186.5 micF
taaaacttttAAGATGTTTCATTTATCGCTatagatgttt
2312888 2312907 nd [GEA], [APIORCISFBSCS], [BPP], [SM] [9], [10], [11], [13], [14]
  OmpR-phosphorylated activator micFp1 Sigma70 -165.5 -165.5 micF
tttatcgctaTAGATGTTTCAAAATGTAAAtgcaagggaa
2312909 2312928 nd [GEA], [APIORCISFBSCS], [BPP], [SM] [8], [9], [10], [11], [13], [14]
  OmpR-phosphorylated activator micFp2 Sigma38 -206.5 -206.5 micF
atccaacacgAATATGATACTAAAACTTTTaagatgtttc
2312868 2312887 nd [GEA], [APIORCISFBSCS], [BPP], [SM] [9], [10], [11], [12], [13]
  OmpR-phosphorylated activator micFp2 Sigma38 -186.5 -186.5 micF
taaaacttttAAGATGTTTCATTTATCGCTatagatgttt
2312888 2312907 nd [GEA], [APIORCISFBSCS], [BPP], [SM] [9], [10], [11], [13], [14]
  OmpR-phosphorylated activator micFp2 Sigma38 -165.5 -165.5 micF
tttatcgctaTAGATGTTTCAAAATGTAAAtgcaagggaa
2312909 2312928 nd [GEA], [APIORCISFBSCS], [BPP], [SM] [8], [9], [10], [11], [13], [14]
  OmpR-phosphorylated repressor nmpCp nd -45.5 nd nmpC
aatcaaacgaGAAACCAAAACTTACATCTTgaaataatca
576906 576925 nd [APIORCISFBSCS], [SM] [15]
  OmpR-phosphorylated activator ompCp1 Sigma70 -88.5 -169.5 ompC
ttcccttgcaTTTACATTTTGAAACATCTAtagcgataaa
2312909 2312928 nd [GEA], [APIORCISFBSCS], [BPP], [SM] [8], [9], [10], [11], [13], [14], [16]
  OmpR-phosphorylated activator ompCp1 Sigma70 -67.5 -148.5 ompC
aaacatctatAGCGATAAATGAAACATCTTaaaagtttta
2312888 2312907 nd [GEA], [APIORCISFBSCS], [BPP], [SM] [9], [10], [11], [13], [14], [16]
  OmpR-phosphorylated activator ompCp1 Sigma70 -47.5 -128.5 ompC
gaaacatcttAAAAGTTTTAGTATCATATTcgtgttggat
2312868 2312887 nd [GEA], [APIORCISFBSCS], [BPP], [SM] [9], [10], [11], [12], [13], [16]
  OmpR-phosphorylated repressor ompFp Sigma70 -370.5 -480.5 ompF
cgatcatcctGTTACGGAATATTACATTGCaacatttacg
987453 987472 nd [GEA], [BPP] [13], [16], [17], [18], [19]
  OmpR-phosphorylated activator ompFp Sigma70 -90.5 -200.5 ompF
ttccttaaatTTTACTTTTGGTTACATATTttttcttttt
987173 987192 nd [GEA], [APIORCISFBSCS], [BPP], [SM] [10], [12], [13], [14], [20], [21], [22], [23]
  OmpR-phosphorylated activator ompFp Sigma70 -70.5 -180.5 ompF
gttacatattTTTTCTTTTTGAAACCAAATctttatcttt
987153 987172 nd [GEA], [APIORCISFBSCS], [BCE], [BPP], [SM] [10], [12], [13], [14], [16], [20], [21], [22], [23], [24], [25]
  OmpR-phosphorylated repressor ompFp Sigma70 -70.5 -180.5 ompF
gttacatattTTTTCTTTTTGAAACCAAATctttatcttt
987153 987172 nd [GEA], [APIORCISFBSCS], [BCE], [BPP], [SM] [10], [12], [13], [14], [16], [20], [21], [22], [23], [24], [25]
  OmpR-phosphorylated activator ompFp Sigma70 -50.5 -160.5 ompF
gaaaccaaatCTTTATCTTTGTAGCACTTTcacggtagcg
987133 987152 nd [GEA], [AIBSCS], [BPP], [SM] [10], [12], [13], [14], [17], [18], [19], [20], [21], [22], [23], [24]
  OmpR-phosphorylated repressor ompFp Sigma70 -50.5 -160.5 ompF
gaaaccaaatCTTTATCTTTGTAGCACTTTcacggtagcg
987133 987152 nd [GEA], [AIBSCS], [BPP], [SM] [10], [12], [13], [14], [17], [18], [19], [20], [21], [22], [23], [24]
  OmpR-phosphorylated repressor ompFp2 Sigma38 -370.5 -480.5 ompF
cgatcatcctGTTACGGAATATTACATTGCaacatttacg
987453 987472 nd [GEA], [BPP] [13], [16], [17], [18], [19]
  OmpR-phosphorylated activator ompFp2 Sigma38 -90.5 -200.5 ompF
ttccttaaatTTTACTTTTGGTTACATATTttttcttttt
987173 987192 nd [GEA], [APIORCISFBSCS], [BPP], [SM] [10], [12], [13], [14], [20], [21], [22], [23]
  OmpR-phosphorylated activator ompFp2 Sigma38 -70.5 -180.5 ompF
gttacatattTTTTCTTTTTGAAACCAAATctttatcttt
987153 987172 nd [GEA], [APIORCISFBSCS], [BCE], [BPP], [SM] [10], [12], [13], [14], [16], [20], [21], [22], [23], [24], [25]
  OmpR-phosphorylated repressor ompFp2 Sigma38 -70.5 -180.5 ompF
gttacatattTTTTCTTTTTGAAACCAAATctttatcttt
987153 987172 nd [GEA], [APIORCISFBSCS], [BCE], [BPP], [SM] [10], [12], [13], [14], [16], [20], [21], [22], [23], [24], [25]
  OmpR-phosphorylated activator ompFp2 Sigma38 -50.5 -160.5 ompF
gaaaccaaatCTTTATCTTTGTAGCACTTTcacggtagcg
987133 987152 nd [GEA], [AIBSCS], [BPP], [SM] [10], [12], [13], [14], [17], [18], [19], [20], [21], [22], [23], [24]
  OmpR-phosphorylated repressor ompFp2 Sigma38 -50.5 -160.5 ompF
gaaaccaaatCTTTATCTTTGTAGCACTTTcacggtagcg
987133 987152 nd [GEA], [AIBSCS], [BPP], [SM] [10], [12], [13], [14], [17], [18], [19], [20], [21], [22], [23], [24]
  OmpR-phosphorylated activator omrAp nd -70.5 -70.5 omrA
accgacaattTACACACCTCGTTGCATTTCccttcattcc
2976250 2976269 nd [GEA], [APIORCISFBSCS] [26]
  OmpR-phosphorylated activator omrBp nd -71.5 -71.5 omrB
aaagagattgCAAACCTTTGGTTACACTTTgcgaaacgct
2976447 2976466 nd [GEA], [APIORCISFBSCS] [26]
  OmpR-phosphorylated repressor pgaAp nd -31.5 -265.5 pgaA, pgaB, pgaC, pgaD
tgcatcggaaTTTACTGATTTAATTATTTTaatcctaatt
1092545 1092564 nd [GEA], [APIORCISFBSCS], [BPP] [27]
  OmpR-phosphorylated repressor srap Sigma38 nd nd sra nd nd nd [GEA], [BPP] [28]
  OmpR-phosphorylated activator tppBp Sigma70 -45.5 -143.5 dtpA
tcagttatatGTAACAGATTATTACAAAGGacttgtctga
1712616 1712635 nd [GEA], [BPP] [29]



High-throughput Transcription factor binding sites (TFBSs)
      

  Functional conformation Function Object name Object type Distance to first Gene Sequence LeftPos RightPos Center Position Growth Condition Evidence (Confirmed, Strong, Weak) References
  OmpR activator pdhR gene -147.5
actttgaaacGTTATATATGTcaagttgtta
121940 121950 121944.5 nd [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [30]
  OmpR activator pdhR gene -137.5
gttatatatgTCAAGTTGTTAaaatgtgcac
121950 121960 121954.5 nd [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [30]
  OmpR activator gmhA gene -170.5
agtggatgtaAAAACATTTAGcaatatgttt
243368 243378 243372.5 nd [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [30]
  OmpR activator fadE gene -69.5
agtggatgtaAAAACATTTAGcaatatgttt
243368 243378 243372.5 nd [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [30]
  OmpR activator gmhA gene -160.5
aaaacatttaGCAATATGTTTacaatataat
243378 243388 243382.5 nd [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [30]
  OmpR activator fadE gene -79.5
aaaacatttaGCAATATGTTTacaatataat
243378 243388 243382.5 nd [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [30]
  OmpR activator acrR gene -37.5
tacatacattCACAAATGTATgtaaatctaa
485719 485729 485723.5 nd [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [30]
  OmpR activator acrR gene -27.5
cacaaatgtaTGTAAATCTAAcgcctgtaaa
485729 485739 485733.5 nd [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [30]
  OmpR activator ybaN gene 5.0
gacaacactcAATATGCAACGAATCATTTtaatcatcat
490879 490897 490887.0 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [31]
  OmpR repressor copA gene -274.0
caaaagatgtTAGATGCAAACAAATTACAgcaggcagtg
511645 511663 511653.0 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [31]
  OmpR activator rhtA gene -300.5
agagtttcccATTAATTTTTGatatatttaa
850393 850403 850397.5 nd [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [30]
  OmpR activator ompX gene -52.5
agagtttcccATTAATTTTTGatatatttaa
850393 850403 850397.5 nd [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [30]
  OmpR activator rhtA gene -310.5
attaatttttGATATATTTAAaacttaggac
850403 850413 850407.5 nd [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [30]
  OmpR activator ompX gene -42.5
attaatttttGATATATTTAAaacttaggac
850403 850413 850407.5 nd [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [30]
  OmpR activator ompF gene -159.0
cgctaccgtgAAAGTGCTACAAAGATAAAgatttggttt
987133 987151 987141.0 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [31]
  OmpR activator ompF gene -189.0
atttggtttcAAAAAGAAAAAATATGTAAccaaaagtaa
987163 987181 987171.0 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [31]
  OmpR activator ompF gene -199.0
aaaaagaaaaAATATGTAACCAAAAGTAAaatttaagga
987173 987191 987181.0 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [31]
  OmpR activator ymdF gene -328.0
attccgtagcGATTCGCTACCACTTATTTaaagataaga
1067745 1067763 1067753.0 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [31]
  OmpR activator narU gene -166.5
taagtagccaGATATGTGTTActaaatgtaa
1544222 1544232 1544226.5 nd [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [30]
  OmpR activator narU gene -172.0
agtagccagaTATGTGTTACTAAATGTAActaacaagct
1544224 1544242 1544232.0 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [31]
  OmpR activator narU gene -176.5
gatatgtgttACTAAATGTAActaacaagct
1544232 1544242 1544236.5 nd [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [30]
  OmpR repressor lpp gene -57.5
ctcaacataaAAAACTTTGTGtaatacttgt
1757359 1757369 1757363.5 nd [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [30]
  OmpR repressor lpp gene -47.5
aaaactttgtGTAATACTTGTaacgctacat
1757369 1757379 1757373.5 nd [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [30]
  OmpR repressor yobB gene -105.0
ttacgagcccAAACTTAAATAAAACTTATacagagttac
1925327 1925345 1925335.0 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [31]
  OmpR activator flhD gene -179.0
aatgggtcttTACACTTATCTAAGATTTTtcctaaatcg
1978368 1978386 1978376.0 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [31]
  OmpR repressor fliA gene -314.0
gtctcagttaATCAGGTTACAACGATTAAccctgcagca
2002095 2002113 2002103.0 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [31]
  OmpR activator ompC gene -127.0
atccaacacgAATATGATACTAAAACTTTtaagatgttt
2312868 2312886 2312876.0 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [31]
  OmpR activator ompC gene -168.0
tttatcgctaTAGATGTTTCAAAATGTAAatgcaaggga
2312909 2312927 2312917.0 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [31]
  OmpR activator mntH gene -288.0
gttttccttaACCATGTTACATAGAATGTgcacggaaat
2512986 2513004 2512994.0 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [31]
  OmpR activator nrdF gene -360.0
tcttatatcaACCATGCTACGTCGAGTATtcatccgatt
2803134 2803152 2803142.0 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [31]
  OmpR activator queE gene 81.0
caaccgggcaTCCCTGTAAACGAATAAAAatggcgggaa
2905329 2905347 2905337.0 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [31]
  OmpR activator queE gene -105.0
tttaaagaaaAATGCGAAACATATCGTTAataattaaag
2905515 2905533 2905523.0 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [31]
  OmpR activator queE gene -188.0
atcatgtcaaAACATTCACCAAAATTATAtttatttttt
2905598 2905616 2905606.0 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [31]
  OmpR activator queE gene -229.0
gtattagtttTTAATGATAACGAATATAAaattaccgat
2905639 2905657 2905647.0 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [31]
  OmpR activator queE gene -269.0
ccgccgtcaaTTTATTTATCCAGATTTAAtgagaaattt
2905679 2905697 2905687.0 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [31]
  OmpR activator tolC gene -245.5
ataatttctaCATCGTTTTTGccaaatgtaa
3177865 3177875 3177869.5 nd [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [30]
  OmpR activator tolC gene -235.5
catcgtttttGCCAAATGTAAcgggcaggtt
3177875 3177885 3177879.5 nd [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [30]
  OmpR repressor alx gene -203.0
catactttgtTACCTGCAAAGGGGAGTAActtcattgcc
3238369 3238387 3238377.0 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [31]
  OmpR repressor sraF gene 3.0
catactttgtTACCTGCAAAGGGGAGTAActtcattgcc
3238369 3238387 3238377.0 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [31]
  OmpR activator sstT gene -65.5
caaacactttGTTACATCCTGaaagatgcgt
3239874 3239884 3239878.5 nd [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [30]
  OmpR activator sstT gene -55.5
gttacatcctGAAAGATGCGTcgacagaacg
3239884 3239894 3239888.5 nd [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [30]
  OmpR repressor bfr gene -377.0
gaataaaaatAATGGGCTACCAAAAGTAGcccattgaca
3467094 3467112 3467102.0 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [31]
  OmpR activator tsgA gene -177.5
ttacctaattTTACGTATCTGaaatatatgt
3492386 3492396 3492390.5 nd [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [30]
  OmpR activator tsgA gene -167.5
ttacgtatctGAAATATATGTaacctgacga
3492396 3492406 3492400.5 nd [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [30]
  OmpR activator yhiD gene -104.0
gcttgattttTGAAGGTATACAAATTTTTctgcgggttt
3655998 3656016 3656006.0 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [31]
  OmpR activator gadE gene -129.0
gaagtattgaTTAGTGTTAATAGACGTATtagttcacga
3658229 3658247 3658237.0 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [31]
  OmpR activator yhjE gene -181.0
acttttatttAACCTGAAACCAGTTTTATccactattta
3674597 3674615 3674605.0 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [31]
  OmpR repressor ibpA gene -311.0
agatgaatttATTATGATAAGAAATGTGTtgttagcgtt
3867725 3867743 3867733.0 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [31]
  OmpR repressor glmZ gene -51.0
attacagaatTATCTCATAACAAGTGTTAagggatgtta
3986373 3986391 3986381.0 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [31]
  OmpR repressor soxS gene -210.0
tgattaccagTATCCGTAACAGCGGCAATcagcggcgat
4277585 4277603 4277593.0 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [31]
  OmpR repressor ytfJ gene -198.0
aattgtaaccTTTAGGTAAAAAAAGTTATacgcggtgga
4439452 4439470 4439460.0 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [31]
  OmpR repressor ytfK gene -127.0
aattgtaaccTTTAGGTAAAAAAAGTTATacgcggtgga
4439452 4439470 4439460.0 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [31]
  OmpR activator fecI gene -11.0
tcagacatgcGGAGTGCATCAAAAGTTAAttatcacgta
4518238 4518256 4518246.0 [1] [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [31]
  OmpR activator rob gene -200.5
tgtaatagatAAAAATGGTAAcaatatgaaa
4635506 4635516 4635510.5 nd [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [30]
  OmpR activator rob gene -210.5
aaaaatggtaACAATATGAAAtacaagcatt
4635516 4635526 4635520.5 nd [AIBSCS], [CEEUMA], [RSE], [AIBSCS], [CEEUMA], [RSE] [30]
  OmpR repressor speF-potE Transcription-Unit nd
nd
nd nd nd nd [GEA], [BPP] [2]
  OmpR-phosphorylated activator sstT Gene nd
aaacactttgTTACATCCTGAAAGATGCGTCgacagaacgc
3239875 3239895 3239884.5 nd [EME], [AIBSPD], [GS] [30]
  OmpR-phosphorylated activator rob Gene nd
gtaatagataAAAATGGTAACAATATGAAATacaagcattt
4635507 4635527 4635516.5 nd [EME], [AIBSPD], [GS] [30]
  OmpR-phosphorylated activator fadE Gene nd
gtggatgtaaAAACATTTAGCAATATGTTTAcaatataatt
243369 243389 243378.5 nd [EME], [AIBSPD], [GS] [30]
  OmpR-phosphorylated activator acrR Gene nd
acatacattcACAAATGTATGTAAATCTAACgcctgtaaat
485720 485740 485729.5 nd [EME], [AIBSPD], [GS] [30]
  OmpR-phosphorylated activator rhtA Gene nd
gagtttcccaTTAATTTTTGATATATTTAAAacttaggact
850394 850414 850403.5 nd [EME], [AIBSPD], [GS] [30]
  OmpR-phosphorylated activator pdhR Gene nd
ctttgaaacgTTATATATGTCAAGTTGTTAAaatgtgcaca
121941 121961 121950.5 nd [EME], [AIBSPD], [GS] [30]
  OmpR-phosphorylated activator ompX Gene nd
gagtttcccaTTAATTTTTGATATATTTAAAacttaggact
850394 850414 850403.5 nd [EME], [AIBSPD], [GS] [30]
  OmpR-phosphorylated activator gmhA Gene nd
gtggatgtaaAAACATTTAGCAATATGTTTAcaatataatt
243369 243389 243378.5 nd [EME], [AIBSPD], [GS] [30]
  OmpR-phosphorylated activator tolC Gene nd
taatttctacATCGTTTTTGCCAAATGTAACgggcaggttg
3177866 3177886 3177875.5 nd [EME], [AIBSPD], [GS] [30]
  OmpR-phosphorylated activator tsgA Gene nd
tacctaatttTACGTATCTGAAATATATGTAacctgacgat
3492387 3492407 3492396.5 nd [EME], [AIBSPD], [GS] [30]
  OmpR-phosphorylated activator narU Gene nd
aagtagccagATATGTGTTACTAAATGTAACtaacaagcta
1544223 1544243 1544232.5 nd [EME], [AIBSPD], [GS] [30]
  OmpR-phosphorylated repressor lpp Gene nd
tcaacataaaAAACTTTGTGTAATACTTGTAacgctacatg
1757360 1757380 1757369.5 nd [EME], [AIBSPD], [GS] [30]
Other High-throughput regulatory interactions with weak evidence


Growth Condition    

 [1] 

C: Escherichia coli str. K-12 substr. MG1655| wild type| M9 minimal medium| sodium chloride 0.3 M; glucose 0.2%| aerobiosis| 37.0 C| mid exponential phase
E: Escherichia coli str. K-12 substr. MG1655| ompR knockout mutant| M9 minimal medium| sodium chloride 0.3 M; glucose 0.2%| aerobiosis| 37.0 C| mid exponential phase



Alignment and PSSM for OmpR TFBSs    

Aligned TFBS of OmpR   
  Sequence
  AATATGTAACCAAAAGTAAAAT
  AACATGTAACTAAATGTAACTC
  AACGAGAAACCAAAACTTACAT
  AAAGTGTAACCAAAGGTTTGCA
  AATATGATACTAAAACTTTTAA
  TATATGTAACAGATTATTACAA
  TAGATGTTTCAAAATGTAAATG
  ATCCTGTTACGGAATATTACAT
  GAAATGCAACGAGGTGTGTAAA
  AAAGTGCTACAAAGATAAAGAT
  TATAGGCAAACATAAATAACAT
  ATTTGGTTTCAAAAAGAAAAAA
  AGCACGTAACATAGTTTGTATA
  TACACTTATCTAAGATTTTTCC
  TATCTTTTTTCAAATATGATCT
  TGACCGAAATCACACTTAAAAA
  GCAGCTTAACAACAAATATTTA
  TTAAAATAATTAAATCAGTAAA
  ACTTTGTAAACAGGGTTTTCTG
  GGGCATTATCTGAACATAAAAC
  TCTATAGCGATAAATGAAACAT

Position weight matrix (PWM). OmpR matrix-quality result   
A	10	12	6	11	3	2	3	14	15	3	6	17	16	15	8	6	4	10	13	8	13	9
C	0	3	5	4	4	0	3	1	0	15	7	0	2	0	2	3	0	0	0	7	3	3
G	3	3	2	4	2	15	1	0	1	0	2	3	2	5	2	7	0	4	0	2	0	2
T	8	3	8	2	12	4	14	6	5	3	6	1	1	1	9	5	17	7	8	4	5	7

Consensus   
;	consensus.strict             	aatatGtaaCcaaatgtaacaa
;	consensus.strict.rc          	TTGTTACATTTGGTTACATATT
;	consensus.IUPAC              	wayatGtaaCcaarwgtwwmaw
;	consensus.IUPAC.rc           	WTKWWACWYTTGGTTACATRTW
;	consensus.regexp             	[at]a[ct]atGtaaCcaa[ag][at]gt[at][at][ac]a[at]
;	consensus.regexp.rc          	[AT]T[GT][AT][AT]AC[AT][CT]TTGGTTACAT[AG]T[AT]

PWM logo   


 


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation




Reference(s)    

 [1] Yamamoto K., Nagura R., Tanabe H., Fujita N., Ishihama A., Utsumi R., 2000, Negative regulation of the bolA1p of Escherichia coli K-12 by the transcription factor OmpR for osmolarity response genes., FEMS Microbiol Lett 186(2):257-62

 [2] Chakraborty S., Winardhi RS., Morgan LK., Yan J., Kenney LJ., 2017, Non-canonical activation of OmpR drives acid and osmotic stress responses in single bacterial cells., Nat Commun 8(1):1587

 [3] Jubelin G., Vianney A., Beloin C., Ghigo JM., Lazzaroni JC., Lejeune P., Dorel C., 2005, CpxR/OmpR interplay regulates curli gene expression in response to osmolarity in Escherichia coli., J Bacteriol 187(6):2038-49

 [4] Ogasawara H., Yamada K., Kori A., Yamamoto K., Ishihama A., 2010, Regulation of the Escherichia coli csgD promoter: interplay between five transcription factors., Microbiology 156(Pt 8):2470-83

 [5] Prigent-Combaret C., Brombacher E., Vidal O., Ambert A., Lejeune P., Landini P., Dorel C., 2001, Complex regulatory network controls initial adhesion and biofilm formation in Escherichia coli via regulation of the csgD gene., J Bacteriol 183(24):7213-23

 [6] Bishop RE., Leskiw BK., Hodges RS., Kay CM., Weiner JH., 1998, The entericidin locus of Escherichia coli and its implications for programmed bacterial cell death., J Mol Biol 280(4):583-96

 [7] Higashitani A., Nishimura Y., Hara H., Aiba H., Mizuno T., Horiuchi K., 1993, Osmoregulation of the fatty acid receptor gene fadL in Escherichia coli., Mol Gen Genet 240(3):339-47

 [8] Gerken H., Vuong P., Soparkar K., Misra R., 2020, Roles of the EnvZ/OmpR Two-Component System and Porins in Iron Acquisition in Escherichia coli., mBio 11(3)

 [9] Coyer J., Andersen J., Forst SA., Inouye M., Delihas N., 1990, micF RNA in ompB mutants of Escherichia coli: different pathways regulate micF RNA levels in response to osmolarity and temperature change., J Bacteriol 172(8):4143-50

 [10] Mattison K., Oropeza R., Byers N., Kenney LJ., 2002, A phosphorylation site mutant of OmpR reveals different binding conformations at ompF and ompC., J Mol Biol 315(4):497-511

 [11] Miyake Y., Yamamoto K., 2020, Epistatic Effect of Regulators to the Adaptive Growth of Escherichia coli., Sci Rep 10(1):3661

 [12] Qin L., Yoshida T., Inouye M., 2001, The critical role of DNA in the equilibrium between OmpR and phosphorylated OmpR mediated by EnvZ in Escherichia coli., Proc Natl Acad Sci U S A 98(3):908-13

 [13] Yoshida T., Qin L., Egger LA., Inouye M., 2006, Transcription regulation of ompF and ompC by a single transcription factor, OmpR., J Biol Chem 281(25):17114-23

 [14] Tsung K., Brissette RE., Inouye M., 1989, Identification of the DNA-binding domain of the OmpR protein required for transcriptional activation of the ompF and ompC genes of Escherichia coli by in vivo DNA footprinting., J Biol Chem 264(17):10104-9

 [15] Coll JL., Heyde M., Portalier R., 1994, Expression of the nmpC gene of Escherichia coli K-12 is modulated by external pH. Identification of cis-acting regulatory sequences involved in this regulation., Mol Microbiol 12(1):83-93

 [16] Oshima T., Aiba H., Masuda Y., Kanaya S., Sugiura M., Wanner BL., Mori H., Mizuno T., 2002, Transcriptome analysis of all two-component regulatory system mutants of Escherichia coli K-12., Mol Microbiol 46(1):281-91

 [17] Huang KJ., Schieberl JL., Igo MM., 1994, A distant upstream site involved in the negative regulation of the Escherichia coli ompF gene., J Bacteriol 176(5):1309-15

 [18] Rampersaud A., Harlocker SL., Inouye M., 1994, The OmpR protein of Escherichia coli binds to sites in the ompF promoter region in a hierarchical manner determined by its degree of phosphorylation., J Biol Chem 269(17):12559-66

 [19] Slauch JM., Silhavy TJ., 1991, cis-acting ompF mutations that result in OmpR-dependent constitutive expression., J Bacteriol 173(13):4039-48

 [20] Forst SA., Delgado J., Inouye M., 1989, DNA-binding properties of the transcription activator (OmpR) for the upstream sequences of ompF in Escherichia coli are altered by envZ mutations and medium osmolarity., J Bacteriol 171(6):2949-55

 [21] Lan CY., Igo MM., 1998, Differential expression of the OmpF and OmpC porin proteins in Escherichia coli K-12 depends upon the level of active OmpR., J Bacteriol 180(1):171-4

 [22] Rampersaud A., Norioka S., Inouye M., 1989, Characterization of OmpR binding sequences in the upstream region of the ompF promoter essential for transcriptional activation., J Biol Chem 264(31):18693-700

 [23] Sato M., Machida K., Arikado E., Saito H., Kakegawa T., Kobayashi H., 2000, Expression of outer membrane proteins in Escherichia coli growing at acid pH., Appl Environ Microbiol 66(3):943-7

 [24] Forst S., Kalve I., Durski W., 1995, Molecular analysis of OmpR binding sequences involved in the regulation of ompF in Escherichia coli., FEMS Microbiol Lett 131(2):147-51

 [25] Ramani N., Huang L., Freundlich M., 1992, In vitro interactions of integration host factor with the ompF promoter-regulatory region of Escherichia coli., Mol Gen Genet 231(2):248-55

 [26] Guillier M., Gottesman S., 2006, Remodelling of the Escherichia coli outer membrane by two small regulatory RNAs., Mol Microbiol 59(1):231-47

 [27] Oropeza R., Salgado-Bravo R., Calva E., 2015, Deletion analysis of RcsC reveals a novel signalling pathway controlling poly-N-acetylglucosamine synthesis and biofilm formation in Escherichia coli., Microbiology 161(Pt 4):903-13

 [28] Izutsu K., Wada C., Komine Y., Sako T., Ueguchi C., Nakura S., Wada A., 2001, Escherichia coli ribosome-associated protein SRA, whose copy number increases during stationary phase., J Bacteriol 183(9):2765-73

 [29] Goh EB., Siino DF., Igo MM., 2004, The Escherichia coli tppB (ydgR) gene represents a new class of OmpR-regulated genes., J Bacteriol 186(12):4019-24

 [30] Shimada T., Takada H., Yamamoto K., Ishihama A., 2015, Expanded roles of two-component response regulator OmpR in Escherichia coli: genomic SELEX search for novel regulation targets., Genes Cells 20(11):915-31

 [31] Seo SW, Gao Y, Kim D, Szubin R, Yang J, Cho BK, Palsson BO, 2017, Revealing genome-scale transcriptional regulatory landscape of OmpR highlights its expanded regulatory roles under osmotic stress in Escherichia coli K-12 MG1655., Sci Rep 1:7



RegulonDB