![]() ![]() |
Synonyms: HipAB |
Summary:
The transcriptional repressor HipB, for "High persistence," is negatively autoregulated and controls the transcription of a critical persistence factor [3, 4, 5, 6, 7, 8]. hipB foms an operon with hipA, and the products of this operon are classified as a toxin (HipA)-antitoxin (HipB) system. This HipAB system is involved in the high persistence, which is the capacity of the bacteria to survive prolonged exposure to antibiotics [8, 9], and Kawano et al. also showed that this system is important for survival during the long-term stationary phase [3, 4, 5]. The crystal structure of the HipB-HipA-DNA complex has been solved at 2.68 Å resolution [10]. The complex is tetrameric and is comprised of a HipB homodimer that interacts with DNA, sandwiched by a monomer of HipA on each side [10]. Read more > |
Transcription factor | ![]() ![]() |
||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
TF conformation(s): |
|
||||||||||||
Connectivity class: | Local Regulator | ||||||||||||
Gene name: | hipA | ||||||||||||
Genome position: | 1590854-1592176 | ||||||||||||
Length: | 1323 bp / 440 aa | ||||||||||||
Operon name: | hipBA | ||||||||||||
TU(s) encoding the TF: |
|
||||||||||||
Gene name: | hipB | ||||||||||||
Genome position: | 1592176-1592442 | ||||||||||||
Length: | 267 bp / 88 aa | ||||||||||||
Operon name: | hipBA | ||||||||||||
TU(s) encoding the TF: |
|
Regulon |
![]() ![]() |
||||||
---|---|---|---|---|---|---|---|
Regulated gene(s) | hipA, hipB, mazE, mazF, relA | ||||||
Multifun term(s) of regulated gene(s) |
MultiFun Term (List of genes associated to the multifun term)
translation (2)
defense/survival (2)
starvation (2)
other (mechanical, nutritional, oxidative stress) (2)
cell killing (2)
Read more >
|
||||||
Regulated operon(s) | hipBA, relA-mazEFG | ||||||
First gene in the operon(s) | hipB, relA | ||||||
Simple and complex regulons | HipAB,HipB HipAB,HipB,IHF | ||||||
Simple and complex regulatory phrases | Regulatory phrase (List of promoters regulated by the phrase) |
Transcription factor regulation |
![]() |
---|
Functional conformation | Function | Promoter | Sigma factor | Central Rel-Pos | Distance to first Gene | Genes | Sequence | LeftPos | RightPos | Evidence (Confirmed, Strong, Weak) | References | |
---|---|---|---|---|---|---|---|---|---|---|---|---|
HipAB | repressor | hipBp | Sigma70 | -85.5 | -125.5 | hipB, hipA |
atcctcctttTTATCCGCGATCGCGGATATcgcagcgttt
|
1592558 | 1592577 | [GEA], [APIORCISFBSCS], [BPP] | [1] | |
HipAB | repressor | hipBp | Sigma70 | -57.5 | -97.5 | hipB, hipA |
atcgcagcgtTTATCCCGTAGAGCGGATAAgatgtgtttc
|
1592530 | 1592549 | [GEA], [APIORCISFBSCS], [BPP] | [1] | |
HipAB | repressor | hipBp | Sigma70 | -18.5 | -58.5 | hipB, hipA |
tccagattgaCTTATCCTCACTAAAGGATAAaacttataat
|
1592491 | 1592511 | [GEA], [APIORCISFBSCS], [BPP] | [1] | |
HipAB | repressor | hipBp | Sigma70 | 10.5 | -30.5 | hipB, hipA |
aaaacttataATATCCCCTTAAGCGGATAAacttgctgtg
|
1592463 | 1592482 | [GEA], [APIORCISFBSCS], [BPP] | [1] | |
HipAB | repressor | relAp1 | Sigma70 | 5.0 | -174.0 | relA, mazE, mazF |
tatagtttatGTATCCTGTAACCCTGCAACGCTGGCTCGGGATAgcgaagcgtt
|
2913809 | 2913842 | [GEA], [BPP] | [2] |
Alignment and PSSM for HipAB TFBSs | ![]() |
---|
Aligned TFBS of HipAB |
---|
Sequence | |
---|---|
GCGTTTATCCCGTAGAGCGGATAAGATGT | |
CTTTTTATCCGCGATCGCGGATATCGCAG | |
AGTTTTATCCTTTAGTGAGGATAAGTCAA | |
AAGTTTATCCGCTTAAGGGGATATTATAA | |
CCTGTAACCCTGCAACGCTGGCTCGGGAT |
Position weight matrix (PWM). HipAB matrix-quality result |
---|
A 2 1 0 0 0 1 5 0 0 0 0 0 0 4 2 2 0 1 0 0 4 0 4 2 0 2 0 4 2 C 2 2 0 0 0 0 0 1 5 5 1 2 1 0 0 2 0 3 0 0 0 1 0 1 1 0 2 0 0 G 1 1 2 1 0 0 0 0 0 0 2 2 1 0 2 0 5 1 4 5 1 0 0 0 3 2 1 1 1 T 0 1 3 4 5 4 0 4 0 0 2 1 3 1 1 1 0 0 1 0 0 4 1 2 1 1 2 0 2 |
Consensus |
---|
; consensus.strict ccttTtAtCCggtagcGcGGataaggcaa ; consensus.strict.rc TTGCCTTATCCGCGCTACCGGATAAAAGG ; consensus.IUPAC mcktTtAtCCkstarmGcGGatawgryaw ; consensus.IUPAC.rc WTRYCWTATCCGCKYTASMGGATAAAMGK ; consensus.regexp [ac]c[gt]tTtAtCC[gt][cg]ta[ag][ac]GcGGata[at]g[ag][ct]a[at] ; consensus.regexp.rc [AT]T[AG][CT]C[AT]TATCCGC[GT][CT]TA[CG][AC]GGATAAA[AC]G[GT] |
Evolutionary conservation of regulatory elements | ![]() |
---|
Reference(s) |
![]() |
---|---|