RegulonDB RegulonDB 10.9: Gene Sequence
modB gene sequence


Size: 690        A: 116  T: 201  G: 202  C: 171

Fasta

 

>modB E. coli K12. Version NC_000913.3 GI:556503834
atgatactgaccgatccagaatggcaggcagttttattaagcctgaaagtttcttccctg
gctgtgctgtttagcctgccgtttgggatcttttttgcctggttactggtgcgttgcacg
tttccgggcaaagctctgctcgacagcgtactgcatctaccgctggtgttaccgcccgtg
gtcgtcggttacttattattagtttcgatgggacggcgcggatttatcggtgaacgtctg
tatgactggtttggtattaccttcgcctttagctggcgcggcgcggttctcgctgccgcc
gtcatgtcgtttccgctgatggtgcgggcaattcgtctggcgctggaaggggttgatgtc
aaactggaacaggccgcaagaacactgggggccgggcgctggcgcgttttctttactatc
acgttaccgctgaccttaccgggaattattgttggtacggtactggcttttgctcgttct
ctcggtgagtttggtgcaaccatcacctttgtgtcgaacattcctggtgaaacgcgaacc
attccttctgccatgtataccctgatccagacccccggcggggaaagtggagcggcgaga
ctgtgcattatttctattgcgctggcgatgatctccctgttgatttcagaatggctggcc
agaatcagccgtgaacgggcggggcgctaa
              
                            

Download fasta file
RegulonDB