RegulonDB RegulonDB 10.9: Gene Sequence
cysZ gene sequence


Size: 762        A: 151  T: 229  G: 191  C: 191

Fasta

 

>cysZ E. coli K12. Version NC_000913.3 GI:556503834
atggtttcatcattcacatctgccccacgcagcggtttttactattttgcgcaaggctgg
aagctcgtctcgcaacctgggattcggcgtttcgttattttaccgctgctggtcaatatt
ttgttgatggggggcgcattctggtggctctttacacagctcgatgtctggatcccgact
ctcatgagttacgttccggactggctacaatggctgagttatctgttgtggcctctggct
gtcatctctgtgctgttagtgtttggctatttcttctccacgattgctaactggattgcc
gctccgtttaacggtttattggctgaacaactggaagcacgattgactggcgctacaccg
ccagataccgggattttcggtatcatgaaagatgtgccgcgaatcatgaaacgcgaatgg
caaaaatttgcctggtatctgccgcgcgcaattgtattactaattctttacttcatccct
ggtattgggcaaaccgtcgcgccggtactgtggttcctgtttagcgcctggatgttagcc
atccagtattgcgattaccccttcgataaccacaaagtgccgtttaaagagatgcgcacc
gccctgcgcacacgcaaaatcaccaatatgcagtttggtgctttaaccagcctgtttacg
atgatcccgctgcttaatctgttcatcatgcccgttgccgtttgtggcgcgacggcgatg
tgggtcgattgctatcgcgataaacacgcgatgtggcggtaa
              
                            

Download fasta file
RegulonDB