RegulonDB RegulonDB 10.8: Gene Sequence
rhsE gene sequence


Size: 2049        A: 507  T: 350  G: 654  C: 538

Fasta

 

>rhsE E. coli K12. Version NC_000913.3 GI:556503834
atgtcgactcgcttaaccaccctcagccataccagtgaaggccaccgcgtgtcggtccac
tacggctatgacgataaaggccgcctgaccggcgaacgccagacggtggagaacccggag
acgggggaactgctgtggcaccatgagaccggacatgcgtacaacgaacaggggctggca
aaccgcgtcacgccggacagtctgccgccggtggagtggctgacctacggcagcggctat
cttgcgggcatgaagctgggcgggacgccgctgctggagttcacgcgcgaccgcctgcac
cgtgagacggtgcgcagcttcggcagcatggcaggcagtaatgccgcatataaactgacc
agcacatacacccccgcaggccagttacagagccagcacctgaacagcctggtgtatgac
cgtgactacgggtggaatgacaacggcgacctggtgcgcatcagcggcccgcgacagacg
cgggaatacggctacagcgccacgggcaggctggagagtgtgcgcaccctcgcaccagac
ctggacatccgcatcccgtatgccacggacccggcgggcaaccggctgccggacccggag
ctgcacccggacagtacactcacagtgtggccggataaccgcatcgcggaggatgcgcac
tatgtctaccgccacgatgaatacggcaggctgacggagaagacggaccgcatcccggcg
ggtgtgatacggacggacgacgagcggacccaccactaccactacgacagccagcaccgc
ctggtgttctacacgcggatacagcatggcgagccactggtcgagagccgctacctctac
gacccgctgggacggcgaatggcaaaacgggtctggcggcgggagcgtgacctgacgggg
tggatgtcgctgtcgcgtaaaccggaggtgacgtggtatggctgggacggagacaggctg
acgacggtgcagactgacaccacacgtatccagacggtatacgagccgggaagcttcacg
ccgctcatccgggtcgagacagagaacggcgagcgggaaaaagcgcagcggcgcagcctg
gcagagacgctccagcaggaagggagtgagaacggccacggcgtggtgttcccggctgaa
ctggtgcggctgctggacaggctggaggaagaaatccgggcagaccgcgtgagcagtgaa
agccgggcgtggcttgcgcagtgcgggctgacggtggagcaactggccagacaggtggag
ccggaatacacaccggcgcgaaaagttcatttttaccactgcgaccaccggggcctgccg
ctggcgctcatcagcgaagacggcaatacggcgtggcgcggggagtatgatgaatggggc
aaccagcttaatgaggagaacccgcatcacctgcaccagccgtaccgtctgccagggcag
cagcatgatgaggagtcggggctgtactataaccgtcaccggcactacgatccgttgcag
gggcggtatatcaccccggacccgattgggttgagaggtggatggaatatgtatcagtat
ccgttgaatcccatacaagtgatagacccaatggggttagatgcgattgagaatatgaca
tcaggtggactaatttatgccgtatctggtgtacctggattgattgctgcaaacagcatt
actaacagtgcttaccagttcggttatgatatggatgctattgttggcggagctcataat
ggggccgccgatgcaatgagacattgttacttgatgtgtcgaatgactaagacatttgga
tcaacaatagctgacgtgataggtaaaaatcatgaggcggcaggggatagacaaggtcag
ccagctaaagaaagaatcatggatcttaaaaataacactgtcggtattgcttgtggcgat
ttttctgccaaatgtagcgatgcatgtattgaaaaatataacactgggcaactcttcggg
ttagatggtataaaagcagataatccaataaaagcaaagcaagggagttcagatgcttca
aattattag
              
                            

Download fasta file
RegulonDB