RegulonDB RegulonDB 10.9: Gene Sequence
yaaA gene sequence


Size: 777        A: 204  T: 187  G: 197  C: 189

Fasta

 

>yaaA E. coli K12. Version NC_000913.3 GI:556503834
atgctgattcttatttcacctgcgaaaacgcttgattaccaaagcccgttgaccaccacg
cgctatacgctgccggagctgttagacaattcccagcagttgatccatgaggcgcggaaa
ctgacgcctccgcagattagcacgctgatgcgcatcagcgacaaactggcgggtatcaac
gccgctcgctttcatgactggcagccagatttcacgccggcgaatgcccgccaggcgatt
ctggcgtttaaaggtgatgtctacaccggcttgcaggccgaaaccttcagcgaagacgat
ttcgattttgcccaacagcatttgcgaatgctttccggcttgtatggcgtactccgcccg
ctcgatttaatgcagccttatcgtctggaaatggggatccgtcttgagaatgcccgaggg
aaagatctgtatcaattctggggagatatcatcaccaacaagctgaacgaggcgctcgca
gcacaaggcgataatgtggtgattaatctggcgtcagatgagtattttaaatcggtgaag
ccgaagaaattgaatgccgagattatcaagccggtgttcctcgatgagaagaacggcaaa
tttaagatcatcagcttctacgctaagaaagcacgcggtctgatgagtcgtttcattatt
gaaaatcggctgaccaaaccagagcaactgactggttttaatagcgaaggttacttcttt
gatgaagattcctccagcaatggcgaactggtgtttaaacgctacgagcagcgttaa
              
                            

Download fasta file
RegulonDB