RegulonDB RegulonDB 10.9: Gene Sequence
cydC gene sequence


Size: 1722        A: 359  T: 437  G: 472  C: 454

Fasta

 

>cydC E. coli K12. Version NC_000913.3 GI:556503834
atgcgcgctttgctaccctatctggcactgtataaacgtcataaatggatgttaagtctt
ggtattgtgctggcaattgtgacgctgctcgccagtatcggtctgttgacactttccggc
tggttcctctcggcctcagcggttgcgggggttgccggactgtacagcttcaactatatg
ctacccgctgcgggcgtgcgtggcgcagcaatcacccgtactgccgggcgctattttgaa
cgtctggtaagtcacgacgcgactttccgcgtgttgcagcatctgcgcatttacaccttc
agcaaattgctgcccctctcccctgccggactggcgcgctatcgtcagggcgaattgctc
aatcgcgtggtggcggatgttgatacgctcgatcatctttacctgcgcgttatctcgccg
ctggtgggcgcttttgtggtgattatggtggtgacaatcgggttaagtttccttgatttc
accctcgcctttacgctgggcggcattatgttactgacgcttttcctgatgccaccgctg
ttttatcgtgcgggaaaaagcaccgggcaaaatctgactcatcttcgcggacagtatcgc
caacaactgacggcctggctgcaagggcaagctgagctgaccatttttggtgccagcgat
cgttatcgcacgcaactagagaatacagaaattcaatggctggaagcgcaacgccgtcaa
tctgaactgaccgcattgtcgcaagcgataatgctgctcattggcgcgttagcggtgatc
ctgatgctgtggatggcgtctggcggcgttggcggcaatgctcaacccggcgcgttaatt
gccctgtttgtcttctgcgcgttagccgcgtttgaagcactggcaccagtaacgggtgca
tttcagcatctggggcaagtcattgcctctgccgtacgtatctctgacttaacggatcaa
aaaccggaggtcacctttcctgatacccaaactcgtgttgccgatcgcgtttcgctgacg
ttacgggatgttcagttcacttatccggagcaatctcaacaggcacttaaagggatttct
cttcaggtaaacgccggggaacatatagcgattctcgggcgaaccggatgcggcaaatca
acactgttacaacagctgacccgcgcatgggacccgcaacagggcgagattttgcttaac
gatagccccatagccagcctgaatgaagcggctctacgacagaccatcagcgttgttcct
cagcgagtgcatctgtttagcgccacgctgcgtgataatcttttactcgcctcgcctggc
agtagtgatgaggctctgtcggagatcttgcgtcgcgttggcctggaaaagctgctcgag
gatgcaggtctcaacagttggttaggtgaaggcggacgccagctctccggtggtgaactg
cgccgtctggctatcgcccgtgcgctgttacatgatgcgccactggtgttgctggatgaa
cctaccgaaggcttagatgccacaaccgaaagccagatccttgaattgcttgcagaaatg
atgcgtgagaaaacggtgttaatggtcacccatcgacttcgcggactctctcgtttccaa
caaataatagtgatggacaacgggcaaattattgagcaaggtactcacgcagaactgctt
gccagacaggggcgttattaccagttcaagcagggtttgtaa
              
                            

Download fasta file
RegulonDB