RegulonDB RegulonDB 10.9: Gene Sequence
mepM gene sequence


Size: 1323        A: 331  T: 298  G: 364  C: 330

Fasta

 

>mepM E. coli K12. Version NC_000913.3 GI:556503834
gtgcaacagatagcccgctctgtcgccctggcgtttaataatttaccgcgaccacaccgc
gttatgttggggtcgctcaccgttcttactctggccgtcgctgtctggcggccttatgtt
tatcaccgtgatgccacgccaattgtcaaaaccattgagctggaacagaacgaaattcgt
tcgctcttacctgaagccagtgagccgattgatcaagctgcacaagaagatgaagccatt
ccccaggacgaactggatgacaaaatcgccggtgaagcgggcgtgcatgaatatgttgtt
tccactggcgatacgctaagcagcattctcaatcagtatggtattgatatgggtgatatc
acccaactggctgcggccgacaaagaattgcgtaacctgaaaatcggtcaacaactctcc
tggacattaaccgcggacggcgaactgcagcgcctcacctgggaagtgtctcgtcgtgaa
acccgaacctatgaccgtactgccgctaacggttttaaaatgaccagcgaaatgcagcaa
ggagagtgggttaacaatctgctgaaaggtaccgtcgggggaagctttgttgccagcgcc
agaaacgccggtttaaccagcgccgaagtgagcgcagtgattaaagccatgcagtggcaa
atggatttccgcaaactgaaaaaaggcgatgaatttgcggtgttaatgtctcgagaaatg
cttgatggtaaacgtgagcaaagccagctgctgggcgtacgtttgcgttcagaaggtaaa
gattattacgctatccgcgctgaagatggcaaattctacgatcgtaacggtactggtctg
gcgaaaggattcttgcgattcccgacggcgaaacagttccgtatctcgtctaattttaac
ccgcgtcgtactaatccggtgaccggtcgcgttgcaccacacagaggtgttgatttcgcc
atgccgcagggtacgccagtgctttcagtgggtgacggtgaagtggtggttgccaaacgc
agtggcgcagcaggttattatgtggctattcgtcatggtcgcagctacaccacgcgttat
atgcacttgcgcaagattctggtgaaaccgggacagaaggtgaaacgtggcgaccgtatc
gcgctttccggtaataccggacgttcaaccgggccgcatctgcactatgaagtatggata
aaccagcaggccgtaaacccgctgacggcaaaactgccgcgtaccgaagggctgaccggc
tccgatcgtcgcgaattcctggcgcaggccaaagagattgtgccgcagctacggtttgat
taa
              
                            

Download fasta file
RegulonDB