RegulonDB RegulonDB 10.9: Gene Sequence
acrD gene sequence


Size: 3114        A: 676  T: 742  G: 888  C: 808

Fasta

 

>acrD E. coli K12. Version NC_000913.3 GI:556503834
atggcgaatttctttattgatcgccccatttttgcctgggtgctggcaatcctgttgtgt
ctgacaggtaccctggcgattttttcattgcccgttgaacaataccccgatctcgcgcca
ccgaatgtgcgagtgaccgctaactatcccggcgcatcggcccagacgctggaaaacacc
gtgacccaggttatcgagcaaaatatgaccggcctcgataatctcatgtatatgtcatct
cagagcagtggcaccggtcaggcatctgtcactttaagttttaaagcaggcaccgatccg
gacgaagccgtgcagcaagtacaaaaccagctgcaatcagccatgcgaaagttaccgcag
gcggtgcaaaatcagggcgtgacggtgcgtaaaaccggcgataccaacattctgaccatt
gccttcgtctctaccgatggttcgatggataaacaggatattgctgattatgttgccagt
aatattcaggacccgttaagccgcgtgaatggcgtcggggatatcgatgcctatggttcg
caatattccatgcgtatctggctggacccggcgaaactcaacagtttccagatgacggct
aaagatgtcactgatgccattgagtcacagaacgcgcagattgcggttgggcaacttggt
ggtacaccttccgtcgataagcaggcgctcaacgccaccattaacgcccagtcactgctg
caaacaccagaacagttccgcgatatcaccttgcgggtcaatcaggacggctcagaggta
aggctgggcgatgtcgccaccgtcgaaatgggggcggagaaatacgattatcttagccgc
ttcaatggtaagccagcctccgggctgggggtaaaactggcctccggcgctaacgaaatg
gcgacagcggagctggtgctcaatcgtctcgacgagctggcgcagtatttcccgcatgga
ctggaatacaaggtggcgtatgaaaccacctcgtttgttaaagcctccattgaagacgtg
gtgaaaacgctgctggaagctatcgctctggttttcctcgttatgtatctgttcctgcaa
aacttccgcgccacgctgatacccactatcgccgtgccggtggtgttgatgggaaccttc
tccgtactttacgccttcggttacagcgtcaacaccttaaccatgttcgcgatggtgctg
gcgatcggtctgctggtggatgacgccatcgtggtggtggaaaacgtcgaacgtattatg
agtgaggaaggactcactcctcgcgaagccacacgtaaatcgatggggcagatccagggg
gcactggtcgggattgcgatggttctttcggcggtatttgtaccaatggccttcttcggc
ggcaccaccggtgccatctatcgccagttctctattaccattgttgcggcgatggtgctg
tcagtactggtagcgatgatcctcactccggctctgtgtgccacactacttaagccactg
aaaaaaggtgagcatcatgggcaaaaaggcttttttgcctggtttaaccagatgtttaac
cgcaacgccgaacgctacgaaaaaggggtggcgaaaattctccaccgtagcctgcgctgg
attgtgatttatgtcctgctgcttggcggcatggtgttcctgttcctgcgtttgccgacg
tcgttcttaccgctggaagaccgtggcatgtttactacctcggtacagttgcccagcggt
tcaacgcaacaacagaccctgaaagtcgttgagcaaatcgagaaatactacttcacccat
gaaaaagacaacatcatgtcggtgtttgccaccgttggttctggccctgggggtaacggg
caaaacgtggcgcgaatgtttatccgcctgaaagactggagcgaacgcgacagtaagacc
ggcacctcgtttgccattatcgagcgtgcaacgaaggcgtttaaccaaattaaagaagct
cgcgttatcgccagcagcccgccagcaattagcggtcttggtagttctgcaggttttgat
atggagttgcaggaccacgctggagcgggtcacgatgcgctgatggcagcacgtaatcag
ttgctggcgctggcggcggaaaacccggagctaacccgtgtgcgccataacggcctcgac
gacagtccgcagttgcagattgatatcgaccagcgtaaagctcaggcgctgggcgttgct
atcgacgatattaacgacacactgcaaaccgcctggggttcgagctatgtgaatgacttt
atggatcgcggtcgcgtgaagaaagtctatgtgcaggcagctgcgccgtatcgcatgctg
ccagatgacatcaatctctggtatgtccgaaataaagatggcggcatggtgcccttctct
gctttcgcgacctcacgctgggaaacaggctcgccgcgtctggaacgctataacggttat
tctgcggttgagattgttggggaagccgcaccgggggtcagtaccggtacggcgatggat
attatggaatcgttagtgaagcagctgccaaacggctttggtctggagtggacggcgatg
tcgtatcaggagcggctttccggcgcgcaggctccggcgctgtacgccatttccttgctg
gtggtattcctgtgtctggctgcgttgtatgaaagctggtcggtgccgttctcggtaatg
ctggtcgtgccgctgggggtaatcggcgcgctgctggcaacctggatgcgcgggctggaa
aacgacgtttacttccaggtgggcctgttaacggtcattggtttatcggcgaaaaacgcc
atcctgatcgtcgagtttgctaacgagatgaaccaaaaaggccacgacctgtttgaagcg
acgctccacgcctgccgtcagcgtttacgcccgattctgatgacctcgctggcatttatc
ttcggcgtattgccaatggcaaccagcacgggtgccggttccggtggtcagcatgcggtg
ggtactggcgtaatgggcgggatgatttcggccactattctggctatttacttcgtgccg
ctgttctttgtgctggtgcgccgccgcttcccgctgaagccgcgcccggaataa
              
                            

Download fasta file
RegulonDB